Chao-Hung Ho

A Comparative Study of Cefepime versus Ceftazidime as Empiric Therapy of Febrile Episodes in Neutropenic Patients

An open-label, randomized comparative study was conducted to evaluate the efficacy and safety of cefepime (2.0 g q. 8 h) and ceftazidime (2.0 g q. 8 h) in the empiric therapy of febrile neutropenic patients. A total of 45 eligible febrile episodes were randomized (1:1) to be treated with the study regimen. Nineteen febrile episodes treated with cefepime and 22 febrile episodes treated with ceftazidime were evaluable for efficacy. The two groups were comparable in terms of age, sex, height, weight, underlying neoplasm, number of pretherapy neutrophil, duration of neutropenia and types of infections. The overall therapeutic success rate of the cefepime group (53%) was comparable to the ceftazidime group (50%). It did not differ significantly (95% confidence interval: –0.28 to 0.34, p = 0.85). Eighty-eight percent of pathogens in each group were bacteriologically eradicated. The safety profile was similar in both groups. No patients in either group discontinued the therapy because of adverse events. None (0%) of the cefepime patients and 2 (9%) of the ceftazidime patients died of infection. The results of this study suggest that cefepime is an effective and safe agent in the empiric therapy of febrile episodes in neutropenic patients.

Cytokine release in febrile non-haemolytic red cell transfusion reactions

Background and Objectives The aim of this study was to elucidate the role and identity of cytokines involved in febrile non‐haemolytic red cell transfusion reactions (FNHTRs).

Influence of methylenetetrahydrofolate reductase (MTHFR) C677T polymorphism, B vitamins and other factors on plasma homocysteine and risk of thromboembolic disease in Chinese

Background: Thromboembolic disease is a major cause of morbidity and mortality in many countries. Our previous study found that Chinese subjects carried the same polymorphism of the methylenetetrahydrofolate reductase (MTHFR) gene as described in Western studies. The aim of the present study was to determine the influence of MTHFR polymorphism, B vitamins and other factors on plasma homocysteine (Hcy) levels and risk of thromboembolic disease in Chinese. Methods: One hundred and six subjects were enrolled into the study. They were categorized into 4 groups: healthy individuals (n = 42); those with diabetes mellitus (n = 20); those with deep vein thrombosis (DVT) (n = 11); and those with coronary artery disease (CAD) (n = 33). Plasma levels of folic acid, vitamins B6 and B12, Hcy, and fasting blood sugar were measured; total cholesterol, triglycerides, complete blood count, and 677 C?T mutation in MTHFR were determined. Results: Plasma Hcy was lowest in the healthy subjects, higher in diabetics, followed by patients with DVT, and highest in patients with CAD (p < 0.001, ANOVA). MTHFR C677T polymorphism was the common factor affecting plasma logHcy levels in all 4 groups of subjects. Triglycerides affected plasma logHcy in the CAD patients. For the 4 groups as a whole, MTHFR polymorphism, triglycerides, and vitamin B12 were the most significant factors influencing plasma Hcy. Conclusion: We suggest that high plasma Hcy is an important risk factor for CAD. Other factors including MTHFR polymorphism, vitamin B12, triglycerides, total cholesterol, and gender might affect Hcy levels in different diseases and conditions.

A novel splicing acceptor mutation of the factor VIII gene producing skipping of exon 25

A gross deletion in the factor VIII (FVIII) mRNA was determined by reverse transcriptase polymerase chain reaction (RT-PCR) for a patient with moderately severe hemophilia A. Sequencing of the RT-PCR product depicted a 177-bp deletion ranging from nucleotide (nt) 6724 to nt 6900 of FVIII cDNA, exactly corresponding to the whole exon 25. Further study of the genomic DNA revealed the presence of a single base pair substitution (G >A) at position –1 of intron 24. The absolute consensus AG doublet of the intron 24 splicing acceptor changed to AA. In the novel splice site mutation, exon 24 was erroneously spliced to exon 26, skipping exon 25. The FVIII antigen level was normal despite the markedly reduced functional activity. Since exon 25 corresponds to part of the C2 domain, we speculate that for this patient the aberrant C2 domain markedly reduces binding affinity of FVIII protein to the phospholipid membrane, thus severely impairing the protein function.

Screening for platelet antibodies in adult idiopathic thrombocytopenic purpura : A comparative study using solid phase red cell adherence assay and flow cytometry

Background: Idiopathic thrombocytopenic purpura (ITP) is an autoimmune disorder caused by antiplatelet autoantibodies. In this study, we compared 2 methods for screening serum platelet antibodies in patients with ITP. Methods: A total of 44 adult patients were clinically classified with ITP. We used 2 indirect tests to detect human leukocyte antigen antibodies and/or platelet‐specific antibodies in their sera. In method I, we used solid phase red cell adherence (SPRCA) assay. In method II, by flow cytometry, platelets from plateletpheresis components were used as target cells, and fluorescein isothiocyanate‐conjugated sheep anti‐human IgG Fc was used as the staining reagent. Positive results were defined as any test with the percentage of fluorescence exceeding the reference range by 3% or more in method II. Direct tests detecting platelet‐associated IgG on platelets of patients with ITP were done by flow cytometry. Results: Serum specimens from 44 adult patients with ITP (28 female, 16 male) were tested. SPRCA assay could only detect platelet antibodies in 22 patients (50%). By method II, 31 serum specimens (70.5%) yielded positive results. There was a difference between the results of the SPRCA test and method II, with a high degree of significance (p < 0.001) by the McNemar test. No significant difference in platelet counts was observed for patients with and without discernible platelet antibodies by SPRCA assay (p = 0.90). The direct test was positive in 12 patients (66.7%) out of 18 ITP patients tested. Conclusion: Flow cytometry is more sensitive than SPRCA assay for detecting platelet antibodies. Detection of platelet antibodies is useful in explaining the immune mechanism and platelet transfusion refractoriness in ITP.

Unappreciated HLA antibodies in adult immune thrombocytopenic purpura.

BACKGROUND/PURPOSE Immune thrombocytopenic purpura (ITP) is an autoimmune disease. Platelet refractoriness is frequently seen in patients with ITP. Platelets express platelet-specific antigens and human leukocyte antigens (HLA). Platelet antibodies to platelet-specific antigens and HLA may be present, but HLA antibodies in patients with ITP have rarely been reported. METHODS Sera from 44 adult patients with ITP were screened for platelet antibodies by two flow cytometric assays. In method I, platelets from normal donor platelets were used as target cells to screen both platelet-specific antibodies and HLA class I antibodies. In method II, the FlowPRA Class I Screening Test kit was used to screen HLA class I antibodies. Fluorescein isothiocyanate (FITC)-conjugated sheep anti-human IgG Fc was used as the staining reagent in both methods. The negative serum control was from one of the normal males with AB blood group who had never received a transfusion. Sera from a pool of five highly sensitized patients were used as the positive control. RESULTS Of the 44 sera from patients with ITP, 31 (70.5%) were method I positive, and 28 (63.6%) were method II positive. There was no significant difference between the results of method I and method II (p = 0.439). The distribution of the results of these two tests was: both tests positive in 22 sera, method I positive and method II negative in nine sera, method I negative and method II positive in six sera, and both tests negative in seven sera. The mean platelet counts of patients with positive (41.0 +/- 40.0 x 10(9)/L) and negative (40.4 +/- 26.8 x 10(9)/L) tests by method I did not differ significantly (p = 0.643). The mean platelet counts of patients with (36.7 +/- 31.5 x 10(9)/L) and without (48.1 +/- 43.6 x 10(9)/L) HLA class I antibodies did not differ significantly (p = 0.59). CONCLUSION HLA class I antibodies are frequently found in ITP. The screening of platelet antibodies including platelet-specific antibodies and unappreciated HLA class I antibodies is warranted in patients with ITP.

Nucleotide changes around the splicing acceptor of intron 24 in the factor VIII gene and its impact on splicing.

Nucleotide 6724 of the factor VIII gene harbors a polymorphism of low frequency. A report from Taiwan claimed that 97.9% of the 83 alleles examined were of the A nucleotide at this position, which is quite different to the data from Western populations. Furthermore, this nucleotide is the start of exon 25, located in juxtaposition to the splicing acceptor of intron 24. We wonder if the nucleotide change at this location might have any effect on the splicing process of pre-mRNA. Using genomic DNA with direct sequencing of the polymerase chain reaction-amplified intron 24/exon 25 junction site, we found that 59 of the 60 patient samples were of the GTG sequence at nucleotides 6724–6726. The polymorphism is similar between populations in Taiwan and Western countries. The sequence of intron 24 around the splicing acceptor was always TCCAACTCTATTGCCCTCAG (-20 to -1), except for one hemophiliac patient who had a mutation in which the absolute consensus AG doublet of the intron 24 splicing acceptor changed to the AA dinucleotide. Owing to the mutation, exon 24 was erroneously spliced to exon 26, and exon 25 was skipped. This finding further testifies to the importance of the invariant AG dinucleotide in the example of the factor VIII gene.