Jie-Yu You

Diagnostic value of serum transferrin receptor and glycosylated hemoglobin on hemolytic anemia

Soluble serum transferritin receptor (sTfR) is a new diagnostic tool for iron depletion and erythropoiesis. Glycosylated hemoglobin (GHb) can be used to detect hemolysis. The present study was thus conducted to compare the diagnostic value of sTfR and GHb (measured as Hb A1c) in patients with hemolytic anemia. Four groups of subjects entered into our study. Group A included 13 patients with hemolytic anemia with effective erythropoiesis (EE). Group B included 13 patients with hemolytic anemia with ineffective erythropoiesis (IE). Group C included 15 healthy controls and group D summated groups A and B. sTfR, serum ferritin, plasma hemoglobin, complete blood count, reticulocyte, haptoglobin, lactic dehydrogenase (LDH), Hb A1c, liver and renal function, direct and indirect bilirubin, and fasting blood sugar were measured. Plasma Hb, hematocrit, mean corpuscular volume (MCV), platelet, haptoglobin, LDH, indirect bilirubin, Hb A1c, and sTfR were found to be significantly different between the controls and the hemolytics, either with effective or ineffective erythropoiesis. Reticulocyte count was significantly different only between the two hemolytic groups. Hb A1c and sTfR were both good for the diagnosis of hemolysis. Reticulocyte count was a good tool for distinguishing EE from IE.

Prognosis and treatment outcome in patients with acute myeloid Leukemia with t(8;21)(q22;q22)

Patients with acute myeloid leukemia (AML) with the t(8;21) karyotype generally have a favorable clinical course, but key prognostic factors remain poorly defined. This study was conducted to determine the prognoses and treatment outcomes of patients with AML with this unique cytogenetic change. A total of 22 patients with AML with t(8;21)(q22;q22) were studied. Various parameters were tested for their impact on disease-free survival (DFS) and overall survival (OS). Another 55 patients with AML with a normal karyotype were included for comparison of clinical outcomes. Between patients with t(8;21) and those with a normal karyotype, no significant differences were noted in DFS (median survival, 15.23 vs 12.03 mo;P=.7626) and OS (median survival, 19.17 vs 18.93 mo;P=.7543). Among t(8;21)(q22;q22) patients, no clinical parameters showed a significant impact on DFS. Univariate analysis revealed that a higher platelet count (> 15·109/L) at diagnosis, a low white blood cell count (index ≤20), and hematopoietic stem cell transplantation (HSCT) as postremission therapy were associated with improved OS. On multivariate analysis, HSCT as postremission therapy and white blood cell count index < 20 remained good independent prognostic factors for OS. The data presented here suggest that t(8;21)(q22;q22) cytogenetic changes in patients with AML had prognostic significance similar to that in patients with a normal karyotype; patients who harbored either karyotype had parallel clinical outcomes. It is concluded that patients with AML with t(8;21)(q22;q22) would be compromised by treatment approaches that do not include HSCT as postremission therapy.

The aPTT assay as a monitor of heparin anticoagulation efficacy in clinical settings.

Activated partial thromboplastin time (aPTT) and prothrombin time (PT) are 2 major methods of screening patients for bleeding tendency. Heparin is an anticoagulant commonly used for various clinical conditions and will thus affect the coagulation profile. The influence of heparin on PT vs aPTT, seldom addressed in the past, should be carefully investigated. Prospective data on 35 patients who were heparinized for clinically indicated conditions were collected and analyzed for the change in PT (dPT) and aPTT (daPTT) at 3 time points after treatment, all of which were compared with baseline data checked before therapy. Age, sex, and the results of a complete blood count and liver and renal function tests were also evaluated for each patient to determine their effects on dPT and daPTT. The therapeutic goal of keeping the aPTT within a desirable range was achieved in ∼75% of patients by the last day of heparin therapy. Within this range, dPTs were not statistically significant, nor was the effect of age, sex, hemoglobin level, serum albumin level, white cell count, platelet count, or renal or hepatic function. In patients with thrombosis, dPT was not significantly influenced by heparin dose. During an overlap in the periods of coumadin and heparin administration, PT was used as a guide for adjusting the coumadin dose. The anticoagulant effect, indicated by a PT in the target range, would occur primarily secondary to coumadin administration and would make it relatively easy to decide when to discontinue heparin.

Nucleotide changes around the splicing acceptor of intron 24 in the factor VIII gene and its impact on splicing.

Nucleotide 6724 of the factor VIII gene harbors a polymorphism of low frequency. A report from Taiwan claimed that 97.9% of the 83 alleles examined were of the A nucleotide at this position, which is quite different to the data from Western populations. Furthermore, this nucleotide is the start of exon 25, located in juxtaposition to the splicing acceptor of intron 24. We wonder if the nucleotide change at this location might have any effect on the splicing process of pre-mRNA. Using genomic DNA with direct sequencing of the polymerase chain reaction-amplified intron 24/exon 25 junction site, we found that 59 of the 60 patient samples were of the GTG sequence at nucleotides 6724–6726. The polymorphism is similar between populations in Taiwan and Western countries. The sequence of intron 24 around the splicing acceptor was always TCCAACTCTATTGCCCTCAG (-20 to -1), except for one hemophiliac patient who had a mutation in which the absolute consensus AG doublet of the intron 24 splicing acceptor changed to the AA dinucleotide. Owing to the mutation, exon 24 was erroneously spliced to exon 26, and exon 25 was skipped. This finding further testifies to the importance of the invariant AG dinucleotide in the example of the factor VIII gene.