Wing-Keung Chau

Influence of methylenetetrahydrofolate reductase (MTHFR) C677T polymorphism, B vitamins and other factors on plasma homocysteine and risk of thromboembolic disease in Chinese

Background: Thromboembolic disease is a major cause of morbidity and mortality in many countries. Our previous study found that Chinese subjects carried the same polymorphism of the methylenetetrahydrofolate reductase (MTHFR) gene as described in Western studies. The aim of the present study was to determine the influence of MTHFR polymorphism, B vitamins and other factors on plasma homocysteine (Hcy) levels and risk of thromboembolic disease in Chinese. Methods: One hundred and six subjects were enrolled into the study. They were categorized into 4 groups: healthy individuals (n = 42); those with diabetes mellitus (n = 20); those with deep vein thrombosis (DVT) (n = 11); and those with coronary artery disease (CAD) (n = 33). Plasma levels of folic acid, vitamins B6 and B12, Hcy, and fasting blood sugar were measured; total cholesterol, triglycerides, complete blood count, and 677 C?T mutation in MTHFR were determined. Results: Plasma Hcy was lowest in the healthy subjects, higher in diabetics, followed by patients with DVT, and highest in patients with CAD (p < 0.001, ANOVA). MTHFR C677T polymorphism was the common factor affecting plasma logHcy levels in all 4 groups of subjects. Triglycerides affected plasma logHcy in the CAD patients. For the 4 groups as a whole, MTHFR polymorphism, triglycerides, and vitamin B12 were the most significant factors influencing plasma Hcy. Conclusion: We suggest that high plasma Hcy is an important risk factor for CAD. Other factors including MTHFR polymorphism, vitamin B12, triglycerides, total cholesterol, and gender might affect Hcy levels in different diseases and conditions.

Primary hypothalamic lymphoma with panhypopituitarism presenting as stiff-man syndrome.

We report an unusual case of primary hypothalamic lymphoma with hypopituitarism presenting as Stiff-man syndrome (SMS). A 64-year-old man was hospitalized due to a 3-week history of general weakness, anorexia, vomiting, weight loss, and muscle pain and spasms precipitated by motion and tactile stimuli resulting in muscle stiffness and difficulty in mobility. Physical examination revealed normal sensorimotor function and reflexes, except for bitemporal visual field defect. Routine laboratory and gastrointestinal examinations provided no remarkable clues. Endocrine assessment revealed low levels of morning cortisol, thyroxine, and anterior pituitary hormones but an increase in prolactin level. The patient’s muscle pain and stiffness improved dramatically within 2 days after hydrocortisone therapy and thyroxine replacement. Magnetic resonance imaging (MRI) of the brain confirmed an 18-mm enhancing hypothalamic tumor with optic chiasm involvement, which proved to be a B-cell lymphoma. The results of the extensive studies for systemic lymphoma were negative, suggesting a primary hypothalamic lymphoma. The tumor regressed completely and was invisible on MRI scan after adjuvant radiotherapy. The patient’s condition was satisfactory and there was no recurrence of SMS during the 2-year follow-up period. This case demonstrated that primary hypothalamic lymphoma complicated with adrenal insufficiency may manifest as SMS. Early diagnosis and prompt intervention can lead to a favorable outcome and reduce morbidity.

A novel splicing acceptor mutation of the factor VIII gene producing skipping of exon 25

A gross deletion in the factor VIII (FVIII) mRNA was determined by reverse transcriptase polymerase chain reaction (RT-PCR) for a patient with moderately severe hemophilia A. Sequencing of the RT-PCR product depicted a 177-bp deletion ranging from nucleotide (nt) 6724 to nt 6900 of FVIII cDNA, exactly corresponding to the whole exon 25. Further study of the genomic DNA revealed the presence of a single base pair substitution (G >A) at position –1 of intron 24. The absolute consensus AG doublet of the intron 24 splicing acceptor changed to AA. In the novel splice site mutation, exon 24 was erroneously spliced to exon 26, skipping exon 25. The FVIII antigen level was normal despite the markedly reduced functional activity. Since exon 25 corresponds to part of the C2 domain, we speculate that for this patient the aberrant C2 domain markedly reduces binding affinity of FVIII protein to the phospholipid membrane, thus severely impairing the protein function.

Combined treatment with splenectomy and cladribine in hairy cell leukemia in Taiwan: a clinicopathologic study of 5 cases.

Background: Hairy cell leukemia (HCL) is a rare B‐cell lymphoid malignancy that is characterized by the presence of hairy cells in the peripheral blood and bone marrow, pancytopenia and various degrees of splenomegaly. Very few reports have explored the clinicopathologic features and treatment outcome of HCL in Taiwan. Methods: Of 33 patients with malignant lymphoma who underwent splenectomy over a 10‐year period (1996–2005), 5 cases of HCL were retrospectively studied. Results: All cases presented with various degrees of splenomegaly. Pancytopenia was noted in 3 cases, and lymphadenopathy in 1. Typical hairy cells with positive tartrate‐resistant acid phosphatase stain were noted in 2 cases. Only 3 cases could be diagnosed with HCL based solely on bone marrow findings. In contrast, all spleen specimens had characteristic pathologic features. All patients underwent splenectomy uneventfully, and cladribine was given at a median time of 2 months after splenectomy without significant side effects. Complete remission with durable response was documented in 4 patients (80%) with a median follow‐up of 29 months (range, 4–96 months). The last patient experienced partial remission but was only followed up for 4 months. Conclusion: For the HCL patients in this study, splenectomy had a role not only in improving cytopenia but in aiding diagnosis. Cladribine is safe and highly effective for Taiwanese patients and should be considered as first‐line treatment for HCL.

Nucleotide changes around the splicing acceptor of intron 24 in the factor VIII gene and its impact on splicing.

Nucleotide 6724 of the factor VIII gene harbors a polymorphism of low frequency. A report from Taiwan claimed that 97.9% of the 83 alleles examined were of the A nucleotide at this position, which is quite different to the data from Western populations. Furthermore, this nucleotide is the start of exon 25, located in juxtaposition to the splicing acceptor of intron 24. We wonder if the nucleotide change at this location might have any effect on the splicing process of pre-mRNA. Using genomic DNA with direct sequencing of the polymerase chain reaction-amplified intron 24/exon 25 junction site, we found that 59 of the 60 patient samples were of the GTG sequence at nucleotides 6724–6726. The polymorphism is similar between populations in Taiwan and Western countries. The sequence of intron 24 around the splicing acceptor was always TCCAACTCTATTGCCCTCAG (-20 to -1), except for one hemophiliac patient who had a mutation in which the absolute consensus AG doublet of the intron 24 splicing acceptor changed to the AA dinucleotide. Owing to the mutation, exon 24 was erroneously spliced to exon 26, and exon 25 was skipped. This finding further testifies to the importance of the invariant AG dinucleotide in the example of the factor VIII gene.