Franco Quadrifoglio

The Many Functions of APE1/Ref-1: Not Only a DNA Repair Enzyme

APE1/Ref-1 (APE1), the mammalian ortholog of Escherichia coli Xth, and a multifunctional protein possessing both DNA repair and transcriptional regulatory activities, has a pleiotropic role in controlling cellular response to oxidative stress. APE1 is the main apurinic/apyrimidinic endonuclease in eukaryotic cells, playing a central role in the DNA base excision repair pathway of all DNA lesions (uracil, alkylated and oxidized, and abasic sites), including single-strand breaks, and has also cotranscriptional activity by modulating genes expression directly regulated by either ubiquitous (i.e., AP-1, Egr-1, NFkappa-B, p53, and HIF) and tissue specific (i.e., PEBP-2, Pax-5 and -8, and TTF-1) transcription factors. In addition, it controls the intracellular redox state by inhibiting the reactive oxygen species (ROS) production. At present, information is still inadequate regarding the molecular mechanisms responsible for the coordinated control of its several activities. Both expression and/or subcellular localization are altered in several metabolic and proliferative disorders such as in tumors and aging. Here, we have attempted to coalesce the most relevant information concerning APE1s different functions in order to shed new light and to focus current and future studies to fully understand this unique molecule that is acquiring more and more interest and translational relevance in the field of molecular medicine.

APE1/Ref-1 Interacts with NPM1 within Nucleoli and Plays a Role in the rRNA Quality Control Process

ABSTRACT APE1/Ref-1 (hereafter, APE1), a DNA repair enzyme and a transcriptional coactivator, is a vital protein in mammals. Its role in controlling cell growth and the molecular mechanisms that fine-tune its different cellular functions are still not known. By an unbiased proteomic approach, we have identified and characterized several novel APE1 partners which, unexpectedly, include a number of proteins involved in ribosome biogenesis and RNA processing. In particular, a novel interaction between nucleophosmin (NPM1) and APE1 was characterized. We observed that the 33 N-terminal residues of APE1 are required for stable interaction with the NPM1 oligomerization domain. As a consequence of the interaction with NPM1 and RNA, APE1 is localized within the nucleolus and this localization depends on cell cycle and active rRNA transcription. NPM1 stimulates APE1 endonuclease activity on abasic double-stranded DNA (dsDNA) but decreases APE1 endonuclease activity on abasic single-stranded RNA (ssRNA) by masking the N-terminal region of APE1 required for stable RNA binding. In APE1-knocked-down cells, pre-rRNA synthesis and rRNA processing were not affected but inability to remove 8-hydroxyguanine-containing rRNA upon oxidative stress, impaired translation, lower intracellular protein content, and decreased cell growth rate were found. Our data demonstrate that APE1 affects cell growth by directly acting on RNA quality control mechanisms, thus affecting gene expression through posttranscriptional mechanisms.

Triple helix formation by oligopurine-oligopyrimidine DNA fragments : electrophoretic and thermodynamic behavior

The 26mer oligodeoxynucleotide d(GAAGGAGGAGATTTTTCTCCTCCTTC) adopts in solution a unimolecular hairpin structure (h), with an oligopurine-oligopyrimidine (Pu-Py) stem. When h is mixed with d(CTTCCTCCTCT) (s1) the two strands co-migrate in polyacrylamide gel electrophoresis at pH 5. If s1 is substituted with d(TCTCCTCCTTC) (s2), such behavior is not observed and the two strands migrate separately. This supports the suggestion of the formation of a triple-stranded structure by h and s1 (h:s1) but not by h and s2, and confirms the strand polarity requirement of the third pyrimidine strand, which is necessary for this type of structure. The formation of a triple helix by h:s1 is supported by electrophoretic mobility data (Ferguson plot) and by enzymatic assay with DNase I. Circular dichroism measurements show that, upon triple helix formation, there are two negative ellipticities: a weaker one (delta epsilon = 80 M-1 cm-1) at 242 nm and a stronger one (delta epsilon = 210 M-1 cm-1) at 212 nm. The latter has been observed also in triple-stranded polynucleotides, and can be considered as the trademark for a Py:Pu:Py DNA triplex. Comparison of ultraviolet absorption at 270 nm and temperature measurements shows that the triple-stranded structure melts with a biphasic profile. The lower temperature transition is bimolecular and is attributable to the breakdown of the triplex to give h and s1, while the higher temperature transition is monomolecular and is due to the transition of hairpin to coil structure. The duplex-to-triplex transition is co-operative, fully reversible and with a hyperchromism of about 10%. The analysis of the melting curves, with a three-state model, allows estimation of the thermodynamic parameters of triple helix formation. We found that the duplex-to-triplex transition of h: s1 is accompanied by an average change in enthalpy (less the protonation contribution) of -73(+/- 5) kcal/mol of triplex, which corresponds to -6.6(+/- 0.4) kcal/mol of binding pyrimidine, attributable to stacking and hydrogen bonding interactions.

Prevalence of Bacterial Vaginosis and Vaginal Flora Changes in Peri- and Postmenopausal Women

ABSTRACT Our aim was to evaluate the prevalence of bacterial vaginosis and decrease in lactobacillus colonization in women 40 years old or older in relation to menopausal status by evaluation of Gram-stained smears. A total of 1,486 smears from Italian Caucasian women aged 40 to 79 years were examined. Women were classified as follows: fertile (regular cycles) (n = 328), perimenopausal (irregular cycles) (n = 237), and postmenopausal (n = 921), including 331 women on estroprogestinic hormone replacement therapy (HRT). The prevalences of bacterial vaginosis (assessed as a Nugent score of ≥7) in fertile (9.8%) and perimenopausal (11.0%) women were not statistically different, whereas the prevalence was significantly lower overall in postmenopausal women (6.0%) (P = 0.02). Specifically, 6.3% of postmenopausal women without HRT and 5.4% of postmenopausal women with HRT were positive for bacterial vaginosis. The Nugent score system was not adequate for evaluating the normal and intermediate vaginal flora in women over the age of 40 years. High numbers of peri- and postmenopausal women had no lactobacilli and no bacterial-vaginosis-associated microorganisms. This nonpathological absence of lactobacilli in women with a Nugent score of 4 was scored as 4∗, and this group was considered separately from the intermediate flora group. A score of 4∗ was obtained for 2.1% of fertile women, 11.4% of perimenopausal women, 44.1% of postmenopausal women without HRT, and 6.9% of postmenopausal women with HRT. The physiological reduction in lactobacillus colonization of the vagina in postmenopausal women does not cause an increase in bacterial-vaginosis prevalence. Reversion of lactobacillus flora to premenopausal levels due to HRT does not increase the prevalence of bacterial vaginosis in postmenopausal women.

Activation of APE1/Ref-1 is dependent on reactive oxygen species generated after purinergic receptor stimulation by ATP

Apurinic apyrimidinic endonuclease redox effector factor-1 (APE1/Ref-1) is involved both in the base excision repair (BER) of DNA lesions and in the eukaryotic transcriptional regulation. APE1/Ref-1 is regulated at both the transcriptional and post-translational levels, through control of subcellular localization and post-translational modification. In response to stress conditions, several cell types release ATP, which exerts stimulatory effects on eukaryotic cells via the purinergic receptors (P2) family. By using western blot and immunofluorescence analysis on a human tumour thyroid cell line (ARO), we demonstrate that purinergic stimulation by extracellular ATP induces quick cytoplasm to nucleus translocation of the protein at early times and its neosynthesis at later times. Continuous purinergic triggering by extracellular ATP released by ARO cells is responsible for the control of APE1/Ref-1 intracellular level. Interference with intracellular pathways activated by P2 triggering demonstrates that Ca2+ mobilization and intracellular reactive oxygen species (ROS) production are responsible for APE1/Ref-1 translocation. The APE1/Ref-1 activities on activator protein-1 (AP-1) DNA binding and DNA repair perfectly match its nuclear enrichment upon ATP stimulation. The biological relevance of our data is reinforced by the observation that APE1/Ref-1 stimulation by ATP protects ARO cells by H2O2-induced cell death. Our data provide new insights into the complex mechanisms regulating APE1/Ref-1 functions.

Understanding different functions of mammalian AP endonuclease (APE1) as a promising tool for cancer treatment

The apurinic endonuclease 1/redox factor-1 (APE1) has a crucial function in DNA repair and in redox signaling in mammals, and recent studies identify it as an excellent target for sensitizing tumor cells to chemotherapy. APE1 is an essential enzyme in the base excision repair pathway of DNA lesions caused by oxidation and alkylation. As importantly, APE1 also functions as a redox agent maintaining transcription factors involved in cancer promotion and progression in an active reduced state. Very recently, a new unsuspected function of APE1 in RNA metabolism was discovered, opening new perspectives for this multifunctional protein. These observations underline the necessity to understand the molecular mechanisms responsible for fine-tuning its different biological functions. This survey intends to give an overview of the multifunctional roles of APE1 and their regulation in the context of considering this protein a promising tool for anticancer therapy.

Immunoglobulin A response against Gardnerella vaginalis hemolysin and sialidase activity in bacterial vaginosis

OBJECTIVE The aim of this study was to investigate the correlation between the immunoglobulin A immune response to Gardnerella vaginalis hemolysin and sialidase activity in vaginal fluids from patients with bacterial vaginosis. STUDY DESIGN Nonpregnant women who were examined at a gynecologic clinic, in an age range of 18 to 62 years, were enrolled. The study population comprised 131 healthy volunteers, 32 women with bacterial vaginosis that was positive for immunoglobulin A to Gardnerella vaginalis hemolysin, 40 women with bacterial vaginosis that was negative for immunoglobulin A to Gardnerella vaginalis hemolysin, and 19 women with Candida vaginitis. Bacterial vaginosis was diagnosed by clinical criteria and Gram stain. RESULTS Sialidase activity was present in 75% (54/72) of patients with bacterial vaginosis. Women having bacterial vaginosis and lacking a specific immunoglobulin A response had a significantly higher level of sialidase activity than patients who had an immune response against Gardnerella vaginalis hemolysin. Sialidase activity was detected in 87% (35/40) of the former subgroup of patients with bacterial vaginosis and in 59% (19/32) of women of the latter subgroup. No sialidase activity was measured in patients with candidiasis. Specificity of the assay for healthy controls was 95% (124/131 women without sialidase activity). CONCLUSIONS Sialidases produced by Prevotella bivia and other microorganisms present in the microflora of patients with bacterial vaginosis are very likely a virulence factor not only by destroying the mucins and enhancing adherence of bacteria but also by impairing a specific immunoglobulin A immune response against other virulence factors such as cytotoxin from Gardnerella vaginalis.

Correlation of Local Interleukin-8 with Immunoglobulin A against Gardnerella vaginalis Hemolysin and with Prolidase and Sialidase Levels in Women with Bacterial Vaginosis

Mucosal immune system activation may represent a critical determinant of adverse consequences associated with bacterial vaginosis (BV), such as sexual human immunodeficiency virus transmission, upper genital tract infections, postsurgical infections, and adverse pregnancy outcomes. Concentrations of sialidase, prolidase, and anti-Gardnerella vaginalis hemolysin (Gvh) immunoglobulin A (IgA) were higher in vaginal fluids of 75 fertile women with BV, compared with concentrations in vaginal fluids of 85 healthy control subjects. Interleukin (IL)-8 levels were positively associated with anti-Gvh IgA response and inversely correlated with high levels of prolidase and sialidase in women with BV. IL-8 concentration was strongly associated with leukocyte count in both healthy and BV-positive women. The absence of leukocytes in most women with BV likely is due to lack of IL-8 induction. Parallel impairment of innate and adaptive mucosal immune factors, likely through microbial hydrolytic effects, may allow for the ascent of microorganisms to the upper genital tract and may facilitate viral infections.

Subcellular localization of APE1/Ref-1 in human hepatocellular carcinoma : Possible prognostic significance

APE1/Ref-1, normally localized in the nucleus, is a regulator of the cellular response to oxidative stress. Cytoplasmic localization has been observed in several tumors and correlates with a poor prognosis. Because no data are available on liver tumors, we investigated APE1/Ref-1 subcellular localization and its correlation with survival in 47 consecutive patients undergoing hepatocellular carcinoma (HCC) resection. APE1/Ref-1 expression was determined by immunohistochemistry in HCC and surrounding liver cirrhosis (SLC) and compared with normal liver tissue. Survival probability was evaluated using Kaplan-Meier curves (log-rank test) and Cox regression. Cytoplasmic expression of APE1/Ref-1 was significantly higher in HCC than in SLC (P = 0.00001); normal liver showed only nuclear reactivity. Patients with poorly differentiated HCC showed a cytoplasmic expression three times higher than those with well-differentiated HCC (P = 0.03). Cytoplasmic localization was associated with a median survival time shorter than those with negative cytoplasmic reactivity (0.44 compared with 1.64 years, P = 0.003), and multivariable analysis confirmed that cytoplasmic APE1/Ref-1 localization is a predictor of survival. Cytoplasmic expression of APE1/Ref-1 is increased in HCC and is associated with a lower degree of differentiation and a shorter survival time, pointing to the use of the cytoplasmic localization of APE1/Ref-1 as a prognostic marker for HCC.

Impairment of the Mucosal Immune System: IgA and IgM Cleavage Detected in Vaginal Washings of a Subgroup of Patients with Bacterial Vaginosis

The integrity of the immunoglobulins in vaginal washings of patients with bacterial vaginosis was examined to answer the question of the lack of immune response against Gardnerella vaginalis cytolysin. Clinically diagnosed patients (n=100) were recruited and their vaginal washings examined by Western blotting. Many showed IgA and IgM partially or extensively degraded. According to the degradation pattern, the patients were subdivided into 4 subsets, from intact (score 0) to completely degraded IgA (score +3). Statistical analysis of the data showed a correlation between IgA degradation and absence of immune response to G. vaginalis cytolysin. The extent of IgA degradation correlated also with the sialidase (but not with the prolidase) activity level. All women showed intact IgG and human serum albumin and no trypsin-like activity. Patients with bacterial vaginosis having high sialidase activity and extensive IgA degradation in their secretions could incur more dangerous infections and adverse pregnancy outcomes.