Luigi E. Xodo

Triple helix formation by oligopurine-oligopyrimidine DNA fragments : electrophoretic and thermodynamic behavior

The 26mer oligodeoxynucleotide d(GAAGGAGGAGATTTTTCTCCTCCTTC) adopts in solution a unimolecular hairpin structure (h), with an oligopurine-oligopyrimidine (Pu-Py) stem. When h is mixed with d(CTTCCTCCTCT) (s1) the two strands co-migrate in polyacrylamide gel electrophoresis at pH 5. If s1 is substituted with d(TCTCCTCCTTC) (s2), such behavior is not observed and the two strands migrate separately. This supports the suggestion of the formation of a triple-stranded structure by h and s1 (h:s1) but not by h and s2, and confirms the strand polarity requirement of the third pyrimidine strand, which is necessary for this type of structure. The formation of a triple helix by h:s1 is supported by electrophoretic mobility data (Ferguson plot) and by enzymatic assay with DNase I. Circular dichroism measurements show that, upon triple helix formation, there are two negative ellipticities: a weaker one (delta epsilon = 80 M-1 cm-1) at 242 nm and a stronger one (delta epsilon = 210 M-1 cm-1) at 212 nm. The latter has been observed also in triple-stranded polynucleotides, and can be considered as the trademark for a Py:Pu:Py DNA triplex. Comparison of ultraviolet absorption at 270 nm and temperature measurements shows that the triple-stranded structure melts with a biphasic profile. The lower temperature transition is bimolecular and is attributable to the breakdown of the triplex to give h and s1, while the higher temperature transition is monomolecular and is due to the transition of hairpin to coil structure. The duplex-to-triplex transition is co-operative, fully reversible and with a hyperchromism of about 10%. The analysis of the melting curves, with a three-state model, allows estimation of the thermodynamic parameters of triple helix formation. We found that the duplex-to-triplex transition of h: s1 is accompanied by an average change in enthalpy (less the protonation contribution) of -73(+/- 5) kcal/mol of triplex, which corresponds to -6.6(+/- 0.4) kcal/mol of binding pyrimidine, attributable to stacking and hydrogen bonding interactions.

Thermodynamic behaviour of the heptadecadeoxynucleotide d(CGCGCGTTTTTCGCGCG) forming B and Z hairpins in aqueous solution.

UV and CD data of the partially self-complementary heptadecadeoxynucleotide d(CGCGCGTTTTTCGCGCG), obtained as a function of temperature, salt and strand concentration, show that: at low NaCl and strand concentration the oligomer exhibits, on increasing the temperature, a biphasic thermal profile which is indicative of two structural transitions, from dimeric duplex to hairpin and from hairpin to coil; the loop stabilizes enthalpically both B and Z hairpin structures with respect to the corresponding unconstrained hexamer d(CGCGCG) by a few Kcal/mol; the oligomer undergoes a B-Z transition which appears to be complete, at 0 degree C, when induced by NaClO4; by contrast the B-Z transition induced by NaCl does not reach completeness even at salt saturation. The independence of the denaturation temperature, at high salt conditions, on the oligomer concentration indicates that the Z structure is present also in the hairpin.

The Duplex-Harpin Conformational Transition of d(CGCGCGATCGCGCG) and d(CGCGCGTACGCGCG): A Thermodynamic and Kinetic Study

Abstract We have studied the duplex-hairpin conformational transition in two perfectly palindromic sequences, d(CGCGCGATCGCGCG)(I) and d(CGCGCGTACGCGCG)(II), by means of UV-melting, electrophoretic and T-jump experiments. Both tetradecamers exhibit biphasic thermal profiles. The lower temperature transition is concentration dependent whereas the higher temperature transition is not. The former transition has been characterized by gel electrophoresis and shows two distinct bands, whose intensity depends on temperature. This behavior is due to the occurrence of a slow premelting interconversion between the duplex and hairpin forms in both tetradecamers. The kinetics of hairpin formation from the duplex is studied by T-jump experiments. Relaxation spectra are well reproduced by a single relaxation time with rate constants characterized by a high temperature coefficient. In 10 mM NaCl, the duplex-hairpin conversion of I is characterized by an apparent activation energy of 96 ± 6 kcal/mol, a value rather close...

Hairpin structures in synthetic oligodeoxynucleotides: sequence effects on the duplex-to-hairpin transition

We have synthesized and examined a number of fully and partly self-complementary palindromic oligodeoxynucleotides for their ability to assume in solution a unimolecular hairpin structure. The main results obtained by a combined optical and electrophoresis investigation show that: (i) DNA folding needs not be driven by mismatched base pairings over the dyad; fully self-complementary palindromic duplexes, comprising regular (CG)n DNA fragments, possess a considerable intrinsic propensity to make intramolecular base pairings; (ii) The duplex-hairpin interconversion is, in general, a slow process independent of the length and base composition of the palindrome; (iii) The palindromic sequences energetically least favored to form hairpin structures consist of C:G base pairs around the dyad axis and of T:A blocks in the arms of the inverted repeat; (IV) The base composition of the stem strongly influences the hairpin thermal stability. For instance, the substitution of one C:G with one A:T base pair in the stem helix of d(CG)7 diminishes the stability of the hairpin by 9 degrees C. It is found that the stability of the stem helix, in hairpins of defined sequence and with the same loop length, decreases in the order alternating-CG greater than homo-CG greater than AC(GT) greater than alternating-AT, i.e. as in polynucleotides. The thermodynamic parameters for the hairpin-coil transition are reported.

Charge effect in the interaction of doxorubicin and derivatives with polydeoxynucleotides

The equilibrium interaction of doxorubicin and its N-acetyl derivative with a series of purine-pyrimidine alternating polydeoxynucleotides has been studied through spectrofluorometry to assess the relevance of the electrostatic contribution to DNA intercalation. The results have shown that: (a) the suppression of the positive charge on the aminosugar has: (I) a profound negative effect on the free energy of intercalation, as expected, and (II) a negligible influence on the base specificity, which supports the notion of an essentially electrostatic effect of N-acetylation on intercalation; (b) a reasonably good accord with the demands of a polyelectrolytic model, due to Friedman and Manning, is found.

The Left-Handed Z-DNA Conformation in Oligodeoxynucleotides Containing Different Amounts of AT Base Pairs: A Far UV Circular Dichroism Study

A number of fully self-complementary oligodeoxynucleotides have been synthesized and examined for their ability to assume the left-handed Z-DNA conformation in high salt solutions. The B- and Z-forms are identified by circular dichroism spectra, covering both the long- (220-300 nm) and short-wavelength (185-220 nm) regions, the latter showing CD bands very useful for identifying the sense of the helix winding. The main results of the study can be summarized as follows: a) sequences composed by AT and CG blocks do support the B to Z transition, even when the AT contents amounts to 50%; b) the occurrence of consecutive purine-purine or pyrimidine-pyrimidine dyads does not inhibit the B to Z transition, although a stronger reduction of water activity is required; c) (AC)n and (GT)n containing oligonucleotides do undergo the B to Z transition in solution; d) a millimolar quantity of Ni2+ concomitant with 5 M NaClO4 is found to be very effective in bringing about the B to Z transition in most of the sequences considered in this study.

G-Rich Triplex-Forming Oligodeoxynucleotides as Transcription Repressors

Abstract The ability of (A,G)- and (G,T)-oligonucleotides to form triple-helices with a critical polypurine-polypyrimidine sequence of the c-Ki-ras promoter has been examined, together with their capacity to inhibit the expression of the chloramphenicol acetyl-transferase gene driven by the c-Ki-ras promoter in a transfected cellular system.