Giorgio Manzini

Triple helix formation by oligopurine-oligopyrimidine DNA fragments : electrophoretic and thermodynamic behavior

The 26mer oligodeoxynucleotide d(GAAGGAGGAGATTTTTCTCCTCCTTC) adopts in solution a unimolecular hairpin structure (h), with an oligopurine-oligopyrimidine (Pu-Py) stem. When h is mixed with d(CTTCCTCCTCT) (s1) the two strands co-migrate in polyacrylamide gel electrophoresis at pH 5. If s1 is substituted with d(TCTCCTCCTTC) (s2), such behavior is not observed and the two strands migrate separately. This supports the suggestion of the formation of a triple-stranded structure by h and s1 (h:s1) but not by h and s2, and confirms the strand polarity requirement of the third pyrimidine strand, which is necessary for this type of structure. The formation of a triple helix by h:s1 is supported by electrophoretic mobility data (Ferguson plot) and by enzymatic assay with DNase I. Circular dichroism measurements show that, upon triple helix formation, there are two negative ellipticities: a weaker one (delta epsilon = 80 M-1 cm-1) at 242 nm and a stronger one (delta epsilon = 210 M-1 cm-1) at 212 nm. The latter has been observed also in triple-stranded polynucleotides, and can be considered as the trademark for a Py:Pu:Py DNA triplex. Comparison of ultraviolet absorption at 270 nm and temperature measurements shows that the triple-stranded structure melts with a biphasic profile. The lower temperature transition is bimolecular and is attributable to the breakdown of the triplex to give h and s1, while the higher temperature transition is monomolecular and is due to the transition of hairpin to coil structure. The duplex-to-triplex transition is co-operative, fully reversible and with a hyperchromism of about 10%. The analysis of the melting curves, with a three-state model, allows estimation of the thermodynamic parameters of triple helix formation. We found that the duplex-to-triplex transition of h: s1 is accompanied by an average change in enthalpy (less the protonation contribution) of -73(+/- 5) kcal/mol of triplex, which corresponds to -6.6(+/- 0.4) kcal/mol of binding pyrimidine, attributable to stacking and hydrogen bonding interactions.

Vertebrate 2xRBD hnRNP proteins: a comparative analysis of genome, mRNA and protein sequences

hnRNP proteins are involved in many cell functions, primarily in pre-mRNA processing. We report here a comparative analysis of the genes of the 2xRBD members of the hnRNP family and of their expression products. Starting from the seven well characterized hnRNP members of human and murine origin (A0, A1, A2/B1, A3, AB, D and DL) and the three MuSashI-like proteins with related RBD tandems (MSI1, MSI2 and DAZAP1), we identified through BLAST search 12 homologous genes in the genome of Danio rerio and 10 in the genome of Takifugu rubripes, which can be divided into three subgroups, each with its highly conserved exon/intron structure, matching perfectly the exon/intron structures found in human and mouse genes. An exception is the gene of hnRNP A0, which is intronless consistently in all the four species. The analysis has been supported also at the level of cDNA and EST databases and extended in this respect to other vertebrate species, namely chicken, Xenopus laevis and Silurana tropicalis. PHYLIP 3.62 package (SEQBOOT, PROTDIST/DNADIST, NEIGHBOR, CONSENSE) was used for all the proteins and their CDSs and human RBDs I and II to infer relevant aspects of the phylogenesis of these proteins. Some clues to the evolution of introns in these genes have come from the analysis of their distribution in homologous genes of other eukaryotes, namely Ciona, Drosophila, Caenorhabditis, Saccharomyces and Arabidopsis.

Copper(II) binding by natural ionic polysaccharides: Part I. Potentiometric and spectroscopic data

Abstract The interaction between copper(II) ions and ionic polysaccharides of natural origin has been studied in 0.05 M NaClO4 aqueous solution at 25°C by means of ion-selective electrode potentiometry, spectrophotometry, and circular dichroism measurements. Many independent variables affect the Cu-polymer interaction: the chemical nature, composition and charge density of the polysaccharide, the copper to polymer ratio, the polymer concentration, and the ionic strength. Moreover, each technique employed seems to show specific features in the binding reaction. A parallel use of different techniques is therefore needed to discriminate between long-range electrostatic and short-range specific modes of interaction.

Thermodynamic behaviour of the heptadecadeoxynucleotide d(CGCGCGTTTTTCGCGCG) forming B and Z hairpins in aqueous solution.

UV and CD data of the partially self-complementary heptadecadeoxynucleotide d(CGCGCGTTTTTCGCGCG), obtained as a function of temperature, salt and strand concentration, show that: at low NaCl and strand concentration the oligomer exhibits, on increasing the temperature, a biphasic thermal profile which is indicative of two structural transitions, from dimeric duplex to hairpin and from hairpin to coil; the loop stabilizes enthalpically both B and Z hairpin structures with respect to the corresponding unconstrained hexamer d(CGCGCG) by a few Kcal/mol; the oligomer undergoes a B-Z transition which appears to be complete, at 0 degree C, when induced by NaClO4; by contrast the B-Z transition induced by NaCl does not reach completeness even at salt saturation. The independence of the denaturation temperature, at high salt conditions, on the oligomer concentration indicates that the Z structure is present also in the hairpin.

Copper(II) binding by natural ionic polysaccharides: Part II. Polarographic data☆

Abstract Differential pulse polarography (d.p.p) was employed to study the interaction of copper(II) ions and carboxylic polysaccharides (pectate, P; algal alginate, AA; bacterial alginate, BA; gul(uronate)-rich oligomers, G; man(nuronate)-rich oligomers, M; alternating man-gul oligomers, MG; and polyacrylate, PAA — the last one for comparison) in 0.05 M NaClO 4 aqueous solution at 25°C. Three main reduction peaks appear in the range of potentials between +0.10 and −0.23 V versus s.c.e. The shapes, the positions of the maxima of the d.p. polarograms, and the areas of the integrated peaks vary with the nature of the polyelectrolyte and with the copper to polymer molar ratio. An attribution of the amount of non-reducible copper ions to a minimum value of bound species is tentatively performed and a comparison with ion selective electrode (i.s.e.) potentiometric results is done. The sequence of copper-binding affinity as determined by d.p.p. is PAA > P > BA ⋍ AA > G > MG > M and it parallels that found potentiometrically using copper ion selective electrodes.

Short oligodeoxynucleotides with d(G-C)n sequence do not assume left-handed conformation in high salt conditions.

d(G-C)n oligodeoxynucleotides (with n varying from 3 to 7) were studied by the circular dichroism technique in 5 M-NaCl. Contrary to what was previously found with the d(C-G)n series in the same solvent, the left-handed double-stranded Z-conformation appears less stable than the B-form for low n values. The influence of base sequence on the relative stability of B- and Z-conformations for the two series is discussed.

Cytosine-block telomeric type DNA-binding activity of hnRNP proteins from human cell lines

Following the observation of the presence in mammalian nuclear extracts of a DNA binding activity quite specific for the single-stranded C-rich telomeric motif, we have isolated from the K562 human cell line by affinity chromatography and identified by mass spectrometry a number of proteins able to bind to this sequence. All of them belong to different heterogeneous nuclear ribonucleoprotein subgroups (hnRNP). Whereas many of them, namely hnRNP K, two isoforms of hnRNP I, and the factor JKTBP, appear to bind to this sequence with limited specificity after isolation, an isoform of hnRNP D (alias AUF1) and particularly hnRNP E1 (alias PCBP-1) show a remarkable specificity for the (CCCTAA)n repeated motif. Both have been obtained also as recombinant proteins expressed in Escherichia coli and have been shown to retain their binding specificity toward the C-block repeated sequence. In the light of the current knowledge about these proteins, their possible involvement in telomere functioning is discussed.

Expression and characterization of human‐elastin‐repeat‐based temperature‐responsive protein polymers for biotechnological purposes

Rapid progress has been made in the design and synthesis of oligomers and polymers that emulate the properties of natural proteins. Molecular bioengineering offers the chance to design and produce artificial polymeric proteins with tailored polymeric properties. The elastin‐like polypeptides are a well‐defined family of polymers with noteworthy characteristic based on the VPGVG repeated motif of bovine elastin. In the human homologue, the most regular sequence is represented by the repetition of the VAPGVG hexapeptidic motif. On the basis of this sequence, a synthetic gene has been designed, cloned and expressed in Escherichia coli to obtain artificial protein polymers. The rapid one‐step in‐frame cloning of any biologically active sequence can be achieved directly in the expression vector, allowing further improvement of the potential of the resulting product.

Interaction of G‐rich GT oligonucleotides with nuclear‐associated eEF1A is correlated with their antiproliferative effect in haematopoietic human cancer cell lines

G‐rich GT oligonucleotides with a different content of G clusters have been evaluated for their ability to exert cytotoxicity and to bind to nuclear‐associated proteins in T‐lymphoblast CCRF‐CEM cells. Only the oligomers that did not form G‐based structures or had a poor structure, under physiological conditions, were able to exert significant cellular growth inhibition effect. The cytotoxicity of these oligomers was related to their binding to the nuclear‐associated eEF1A protein, but not to the recognition of nucleolin or other proteins. In particular, GT oligomers adopting a conformation compatible with G‐quadruplex, did not exert cytotoxicity and did not bind to eEF1A. The overall results suggest that the ability of oligomers to adopt a G‐quadruplex‐type secondary structure in a physiological buffer containing 150 mm NaCl is not a prerequisite for antiproliferative effect in haematopoietic cancer cells. The cytotoxicity of G‐rich GT oligomers was shown to be tightly related to their binding affinity for eEF1A protein.

The Duplex-Harpin Conformational Transition of d(CGCGCGATCGCGCG) and d(CGCGCGTACGCGCG): A Thermodynamic and Kinetic Study

Abstract We have studied the duplex-hairpin conformational transition in two perfectly palindromic sequences, d(CGCGCGATCGCGCG)(I) and d(CGCGCGTACGCGCG)(II), by means of UV-melting, electrophoretic and T-jump experiments. Both tetradecamers exhibit biphasic thermal profiles. The lower temperature transition is concentration dependent whereas the higher temperature transition is not. The former transition has been characterized by gel electrophoresis and shows two distinct bands, whose intensity depends on temperature. This behavior is due to the occurrence of a slow premelting interconversion between the duplex and hairpin forms in both tetradecamers. The kinetics of hairpin formation from the duplex is studied by T-jump experiments. Relaxation spectra are well reproduced by a single relaxation time with rate constants characterized by a high temperature coefficient. In 10 mM NaCl, the duplex-hairpin conversion of I is characterized by an apparent activation energy of 96 ± 6 kcal/mol, a value rather close...