Fuquan Hu

SalK/SalR, a Two-Component Signal Transduction System, Is Essential for Full Virulence of Highly Invasive Streptococcus suis Serotype 2

Background Streptococcus suis serotype 2 (S. suis 2, SS2) has evolved into a highly infectious entity, which caused the two recent large-scale outbreaks of human SS2 epidemic in China, and is characterized by a toxic shock-like syndrome. However, the molecular pathogenesis of this new emerging pathogen is still poorly understood. Methodology/Principal Findings 89K is a newly predicted pathogenicity island (PAI) which is specific to Chinese epidemic strains isolated from these two SS2 outbreaks. Further bioinformatics analysis revealed a unique two-component signal transduction system (TCSTS) located in the candidate 89K PAI, which is orthologous to the SalK/SalR regulatory system of Streptococcus salivarius. Knockout of salKR eliminated the lethality of SS2 in experimental infection of piglets. Functional complementation of salKR into the isogenic mutant ΔsalKR restored its soaring pathogenicity. Colonization experiments showed that the ΔsalKR mutant could not colonize any susceptible tissue of piglets when administered alone. Bactericidal assays demonstrated that resistance of the mutant to polymorphonuclear leukocyte (PMN)-mediated killing was greatly decreased. Expression microarray analysis exhibited a transcription profile alteration of 26 various genes down-regulated in the ΔsalKR mutant. Conclusions/Significance These findings suggest that SalK/SalR is requisite for the full virulence of ethnic Chinese isolates of highly pathogenic SS2, thus providing experimental evidence for the validity of this bioinformatically predicted PAI.

GI-type T4SS-mediated horizontal transfer of the 89K pathogenicity island in epidemic Streptococcus suis serotype 2.

Pathogenicity islands (PAIs), a distinct type of genomic island (GI), play important roles in the rapid adaptation and increased virulence of pathogens. 89K is a newly identified PAI in epidemic Streptococcus suis isolates that are related to the two recent large‐scale outbreaks of human infection in China. However, its mechanism of evolution and contribution to the epidemic spread of S. suis 2 remain unknown. In this study, the potential for mobilization of 89K was evaluated, and its putative transfer mechanism was investigated. We report that 89K can spontaneously excise to form an extrachromosomal circular product. The precise excision is mediated by an 89K‐borne integrase through site‐specific recombination, with help from an excisionase. The 89K excision intermediate acts as a substrate for lateral transfer to non‐89K S. suis 2 recipients, where it reintegrates site‐specifically into the target site. The conjugal transfer of 89K occurred via a GI type IV secretion system (T4SS) encoded in 89K, at a frequency of 10−6 transconjugants per donor. This is the first demonstration of horizontal transfer of a Gram‐positive PAI mediated by a GI‐type T4SS. We propose that these genetic events are important in the emergence, pathogenesis and persistence of epidemic S. suis 2 strains.

The involvement of sortase A in high virulence of STSS-causing Streptococcus suis serotype 2.

Sortase A (SrtA), originally identified as a transpeptidase in Staphylococcus aureus, plays key roles in full virulence of pathogenic bacteria. In silico genome-wide search suggested a srtA homologue from 05ZYH33, a Chinese human isolate of streptococcal toxic shock syndrome (STSS)-causing Streptococcus suis serotype 2 (S. suis 2, SS2). An isogenic srtA mutant (ΔsrtA) of 05ZYH33 strain was obtained by homologous recombination. Immunofluorescence analysis revealed that two known virulence-associated surface proteins featuring Leu-Pro-X-Thr-Gly motif, muramidase-released protein and surface antigen one, were absent in the ΔsrtA. Piglet infection experiments showed that deletion of srtA attenuated the full virulence of 05ZYH33 strain, and impaired its colonizing potential in specific organs. Furthermore, the ΔsrtA displayed significant reduction in adherence to human cells (Hep-2 and human umbilical vein endothelial cells). Collectively, we concluded that SrtA was involved in the virulence manifestation of STSS-causing SS2.

The Orphan Response Regulator CovR: a Globally Negative Modulator of Virulence in Streptococcus suis Serotype 2

Streptococcus suis serotype 2 is an emerging zoonotic pathogen responsible for a wide range of life-threatening diseases in pigs and humans. However, the pathogenesis of S. suis serotype 2 infection is not well understood. In this study, we report that an orphan response regulator, CovR, globally regulates gene expression and negatively controls the virulence of S. suis 05ZYH33, a streptococcal toxic shock syndrome (STSS)-causing strain. A covR-defective (DeltacovR) mutant of 05ZYH33 displayed dramatic phenotypic changes, such as formation of longer chains, production of thicker capsules, and increased hemolytic activity. Adherence of the DeltacovR mutant to epithelial cells was greatly increased, and its resistance to phagocytosis and killing by neutrophils and monocytes was also significantly enhanced. More importantly, inactivation of covR increased the lethality of S. suis serotype 2 in experimental infection of piglets, and this phenotype was restored by covR complementation. Colonization experiments also showed that the DeltacovR mutant exhibited an increased ability to colonize susceptible tissues of piglets. The pleiotropic phenotype of the DeltacovR mutant is in full agreement with the large number of genes controlled by CovR as revealed by transcription profile analysis: 2 genes are positively regulated, and 193 are repressed, including many that encode known or putative virulence factors. These findings suggested that CovR is a global repressor in virulence regulation of STSS-causing S. suis serotype 2.

Contribution of the Rgg Transcription Regulator to Metabolism and Virulence of Streptococcus suis Serotype 2

ABSTRACT The Rgg-like regulators, a family of transcription factors commonly found in many Gram-positive bacteria, play multiple roles, especially in the control of pathogen virulence. Here, we report an rgg homologue from a Chinese isolate, 05ZYH33, of Streptococcus suis serotype 2 (SS2). Deletion of the rgg gene in SS2 increased its adhesion to Hep-2 cells and hemolytic activity in vitro. Significantly, inactivation of the rgg gene attenuated SS2 virulence in an experimental piglet infection model. Using DNA microarrays and quantitative reverse transcription-PCR, we found that the Rgg regulator affects the transcriptional profile of 15.87% (n = 345) of all of the annotated chromosomal genes, including those involved in nonglucose carbohydrate metabolism, DNA recombination, protein biosynthesis, bacterial defense mechanisms, and others. It was experimentally verified that the deletion of rgg in SS2 reduced the utilization of nonglucose carbohydrates, such as lactose and maltose. In addition, the rgg gene was found to be associated with changes in the bacterial microscopic phenotype and growth curve. These data suggested that Rgg in SS2 is a global transcriptional regulator that plays an important role in promoting SS2 bacterial survival during pathogen-host interaction.

Whole genome sequencing of a novel temperate bacteriophage of P. aeruginosa: evidence of tRNA gene mediating integration of the phage genome into the host bacterial chromosome

Whole genome sequencing of a novel Pseudomonas aeruginosa temperate bacteriophage PaP3 has been completed. The genome contains 45 503 bp with GC content of 52.1%, without more than 100 bp sequence hitting homologue in all sequenced phage genomes. A total of 256 open reading frames (ORFs) are found in the genome, and 71 ORFs are predicated as coding sequence (CDS). All 71 CDS are divided into the two opposite direction groups, and both groups meet at the bidirectional terminator site locating the near middle of the genome. The genome is dsDNA with 5′‐protruded cohesive ends and cohesive sequence is ′GCCGGCCCCTTTCCGCGTTA′ (20 mer). There are four tRNA genes (tRNAAsn, tRNAAsp, tRNATyr and tRNAPro) clustering at the 5′‐terminal of the genome. Analysis of integration site of PaP3 in the host bacterial genome confirmed that the core sequence of (GGTCGTAGGTTCGAATCCTAC‐21mer) locates at tRNAPro gene within the attP region and at tRNALys gene in the attB region. The results indicated that 3′‐end of tRNAPro gene of the PaP3 genome is involved in the integration reaction and 5′‐end of tRNALys gene of host bacteria genome is hot spot of the integration.

Role of a Type IV–Like Secretion System of Streptococcus suis 2 in the Development of Streptococcal Toxic Shock Syndrome

Streptococcus suis serotype 2 (S. suis 2) has evolved into a highly invasive pathogen that was found to be the cause of 2 large-scale outbreaks of streptococcus toxic shock syndrome (STSS) in China. However, the mechanism of action of this non-group A streptococcal (GAS) S. suis-caused STSS is still unknown. Previously, we identified a unique pathogenicity island (PAI) designated 89K that is specific to the STSS-causing epidemic strains of S. suis 2. In this study, we further report a functional type IV-like secretion system (T4SS-like system) harbored in the 89K PAI that contributes to the development of STSS. Knockout of the 2 key components (VirD4-89K and VirB4-89K) of the T4SS-like system eliminated the lethality of the highly virulent strain and impaired its ability to trigger host immune response in experimental infection of mice. Our findings provide a new insight into the pathogenesis of STSS caused by the highly pathogenic S. suis 2 isolates.

Identification and Experimental Verification of Protective Antigens Against Streptococcus suis Serotype 2 Based on Genome Sequence Analysis

Streptococcus suis serotype 2 (S. suis 2) is an important zoonotic pathogen that can cause severe disease and even death in both humans and swine. No effective vaccine is clinically available. In this study, a reverse vaccinology method was first applied to identify protective antigens against S. suis 2. As a consequence, 153 genes encoding vaccine candidates were selected from the whole genome sequence by means of bioinformatics analysis, from which 10 genes were selected based on experimental evidences arising from the study of related bacteria such as Streptococcus pneumoniae, group B streptococcus, S. suis and so on. Of 10 target genes, 8 were successfully expressed in Escherichia coli Rosetta, and expressed proteins were purified and used as the immunogens for evaluating vaccine efficacy in a mouse infection model. The results have confirmed that RTX family exoprotein A (RfeA), epidermal surface antigen (ESA), immunoglobulin G (IgG)-binding protein (IBP), and suilysin (SLY) can induce a protective response of the vaccinated animals against S. suis 2, whereas RfeA, ESA, and IBP mainly induce humoral-mediated immunity, and SLY elicits a combined pattern of both humoral- and cellular-mediated immunity. Although immunoprotection of SLY against S. suis 2 was reported previously, RfeA, ESA, and IBP were explored first in this study.

Mapping the tail fiber as the receptor binding protein responsible for differential host specificity of Pseudomonas aeruginosa bacteriophages PaP1 and JG004.

The first step in bacteriophage infection is recognition and binding to the host receptor, which is mediated by the phage receptor binding protein (RBP). Different RBPs can lead to differential host specificity. In many bacteriophages, such as Escherichia coli and Lactococcal phages, RBPs have been identified as the tail fiber or protruding baseplate proteins. However, the tail fiber-dependent host specificity in Pseudomonas aeruginosa phages has not been well studied. This study aimed to identify and investigate the binding specificity of the RBP of P. aeruginosa phages PaP1 and JG004. These two phages share high DNA sequence homology but exhibit different host specificities. A spontaneous mutant phage was isolated and exhibited broader host range compared with the parental phage JG004. Sequencing of its putative tail fiber and baseplate region indicated a single point mutation in ORF84 (a putative tail fiber gene), which resulted in the replacement of a positively charged lysine (K) by an uncharged asparagine (N). We further demonstrated that the replacement of the tail fiber gene (ORF69) of PaP1 with the corresponding gene from phage JG004 resulted in a recombinant phage that displayed altered host specificity. Our study revealed the tail fiber-dependent host specificity in P. aeruginosa phages and provided an effective tool for its alteration. These contributions may have potential value in phage therapy.

Genomic and Proteomic Analyses of the Terminally Redundant Genome of the Pseudomonas aeruginosa Phage PaP1: Establishment of Genus PaP1-Like Phages

We isolated and characterized a new Pseudomonas aeruginosa myovirus named PaP1. The morphology of this phage was visualized by electron microscopy and its genome sequence and ends were determined. Finally, genomic and proteomic analyses were performed. PaP1 has an icosahedral head with an apex diameter of 68–70 nm and a contractile tail with a length of 138–140 nm. The PaP1 genome is a linear dsDNA molecule containing 91,715 base pairs (bp) with a G+C content of 49.36% and 12 tRNA genes. A strategy to identify the genome ends of PaP1 was designed. The genome has a 1190 bp terminal redundancy. PaP1 has 157 open reading frames (ORFs). Of these, 143 proteins are homologs of known proteins, but only 38 could be functionally identified. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis and high-performance liquid chromatography-mass spectrometry allowed identification of 12 ORFs as structural protein coding genes within the PaP1 genome. Comparative genomic analysis indicated that the Pseudomonas aeruginosa phage PaP1, JG004, PAK_P1 and vB_PaeM_C2-10_Ab1 share great similarity. Besides their similar biological characteristics, the phages contain 123 core genes and have very close phylogenetic relationships, which distinguish them from other known phage genera. We therefore propose that these four phages be classified as PaP1-like phages, a new phage genus of Myoviridae that infects Pseudomonas aeruginosa.