Xiancai Rao

GI-type T4SS-mediated horizontal transfer of the 89K pathogenicity island in epidemic Streptococcus suis serotype 2.

Pathogenicity islands (PAIs), a distinct type of genomic island (GI), play important roles in the rapid adaptation and increased virulence of pathogens. 89K is a newly identified PAI in epidemic Streptococcus suis isolates that are related to the two recent large‐scale outbreaks of human infection in China. However, its mechanism of evolution and contribution to the epidemic spread of S. suis 2 remain unknown. In this study, the potential for mobilization of 89K was evaluated, and its putative transfer mechanism was investigated. We report that 89K can spontaneously excise to form an extrachromosomal circular product. The precise excision is mediated by an 89K‐borne integrase through site‐specific recombination, with help from an excisionase. The 89K excision intermediate acts as a substrate for lateral transfer to non‐89K S. suis 2 recipients, where it reintegrates site‐specifically into the target site. The conjugal transfer of 89K occurred via a GI type IV secretion system (T4SS) encoded in 89K, at a frequency of 10−6 transconjugants per donor. This is the first demonstration of horizontal transfer of a Gram‐positive PAI mediated by a GI‐type T4SS. We propose that these genetic events are important in the emergence, pathogenesis and persistence of epidemic S. suis 2 strains.

Whole genome sequencing of a novel temperate bacteriophage of P. aeruginosa: evidence of tRNA gene mediating integration of the phage genome into the host bacterial chromosome

Whole genome sequencing of a novel Pseudomonas aeruginosa temperate bacteriophage PaP3 has been completed. The genome contains 45 503 bp with GC content of 52.1%, without more than 100 bp sequence hitting homologue in all sequenced phage genomes. A total of 256 open reading frames (ORFs) are found in the genome, and 71 ORFs are predicated as coding sequence (CDS). All 71 CDS are divided into the two opposite direction groups, and both groups meet at the bidirectional terminator site locating the near middle of the genome. The genome is dsDNA with 5′‐protruded cohesive ends and cohesive sequence is ′GCCGGCCCCTTTCCGCGTTA′ (20 mer). There are four tRNA genes (tRNAAsn, tRNAAsp, tRNATyr and tRNAPro) clustering at the 5′‐terminal of the genome. Analysis of integration site of PaP3 in the host bacterial genome confirmed that the core sequence of (GGTCGTAGGTTCGAATCCTAC‐21mer) locates at tRNAPro gene within the attP region and at tRNALys gene in the attB region. The results indicated that 3′‐end of tRNAPro gene of the PaP3 genome is involved in the integration reaction and 5′‐end of tRNALys gene of host bacteria genome is hot spot of the integration.

Genomic and Proteomic Analyses of the Terminally Redundant Genome of the Pseudomonas aeruginosa Phage PaP1: Establishment of Genus PaP1-Like Phages

We isolated and characterized a new Pseudomonas aeruginosa myovirus named PaP1. The morphology of this phage was visualized by electron microscopy and its genome sequence and ends were determined. Finally, genomic and proteomic analyses were performed. PaP1 has an icosahedral head with an apex diameter of 68–70 nm and a contractile tail with a length of 138–140 nm. The PaP1 genome is a linear dsDNA molecule containing 91,715 base pairs (bp) with a G+C content of 49.36% and 12 tRNA genes. A strategy to identify the genome ends of PaP1 was designed. The genome has a 1190 bp terminal redundancy. PaP1 has 157 open reading frames (ORFs). Of these, 143 proteins are homologs of known proteins, but only 38 could be functionally identified. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis and high-performance liquid chromatography-mass spectrometry allowed identification of 12 ORFs as structural protein coding genes within the PaP1 genome. Comparative genomic analysis indicated that the Pseudomonas aeruginosa phage PaP1, JG004, PAK_P1 and vB_PaeM_C2-10_Ab1 share great similarity. Besides their similar biological characteristics, the phages contain 123 core genes and have very close phylogenetic relationships, which distinguish them from other known phage genera. We therefore propose that these four phages be classified as PaP1-like phages, a new phage genus of Myoviridae that infects Pseudomonas aeruginosa.

Molecular and phenotypic evidence for the spread of three major methicillin-resistant Staphylococcus aureus clones associated with two characteristic antimicrobial resistance profiles in China

OBJECTIVES The distribution of methicillin-resistant Staphylococcus aureus (MRSA) clones is dynamic and geographically unique. To understand the changing epidemiology of MRSA infections in China, we performed a prospective, multicity surveillance study with molecular typing and phenotypic analysis to determine the association of major prevalent clones with their antimicrobial resistance profiles. METHODS A total of 517 S. aureus isolates collected between January 2009 and March 2012 from six cities in China were subjected to antibiogram analysis and molecular typing, including staphylococcal cassette chromosome mec typing, multilocus sequence typing, staphylococcal protein A gene typing and PFGE typing. RESULTS Among the isolates collected, 309 were characterized as MRSA, with a prevalence of 59.8%. Three major clones were found to be prevalent in China: ST239-MRSA-III-t030, ST239-MRSA-III-t037 and ST5-MRSA-II-t002. These three clones were associated with two characteristic resistance profiles, namely, gentamicin/ciprofloxacin/rifampicin/levofloxacin for the first clone and gentamicin/ciprofloxacin/clindamycin/erythromycin/tetracycline/levofloxacin/trimethoprim/sulfamethoxazole for the latter two. Several geographically unique minor clones were also identified. CONCLUSIONS The predominant MRSA clones in China were associated with characteristic antimicrobial resistance profiles. Antibiotics for treating patients with MRSA infections can be selected based on the strain typing data.

Chromosomal DNA deletion confers phage resistance to Pseudomonas aeruginosa

Bacteria develop a broad range of phage resistance mechanisms, such as prevention of phage adsorption and CRISPR/Cas system, to survive phage predation. In this study, Pseudomonas aeruginosa PA1 strain was infected with lytic phage PaP1, and phage-resistant mutants were selected. A high percentage (~30%) of these mutants displayed red pigmentation phenotype (Red mutant). Through comparative genomic analysis, one Red mutant PA1r was found to have a 219.6 kb genomic fragment deletion, which contains two key genes hmgA and galU related to the observed phenotypes. Deletion of hmgA resulted in the accumulation of a red compound homogentisic acid; while A galU mutant is devoid of O-antigen, which is required for phage adsorption. Intriguingly, while the loss of galU conferred phage resistance, it significantly attenuated PA1r in a mouse infection experiment. Our study revealed a novel phage resistance mechanism via chromosomal DNA deletion in P. aeruginosa.

Cell wall thickening is associated with adaptive resistance to amikacin in methicillin-resistant Staphylococcus aureus clinical isolates

OBJECTIVES Methicillin-resistant Staphylococcus aureus (MRSA) infection is increasing and causing global concern. The mechanism of MRSA resistance to amikacin is poorly understood. We report on the first matched-pair study to reveal that the phenotypic cell wall thickening of MRSA is associated with adaptive resistance to amikacin. METHODS Two MRSA strains (CY001 and CY002) were isolated from blood and synovial fluid samples, respectively, from a 12-year-old male patient with osteomyelitis. The strains were subjected to a matched-pair study, including antimicrobial agent susceptibility determination, molecular typing, morphological observation and in vitro resistance induction. RESULTS Both strains are Panton-Valentine leucocidin-positive, multilocus sequence type 59, staphylococcal cassette chromosome mec type IV and spa type 437 MRSA with identical PFGE profiles. The drug susceptibility spectra of the two isolates are similar. However, CY001 is resistant to amikacin (CY001-AMI(R); MIC = 64 mg/L), contrary to the susceptible CY002 (CY002-AMI(S); MIC = 8 mg/L). CY001-AMI(R) may have developed adaptive resistance, because it lacks aminoglycoside-modifying enzymes and has an altered growth curve. Interestingly, CY001-AMI(R) has a thicker cell wall (36.43 ± 4.25 nm) than CY002-AMI(S) (18.15 ± 3.74 nm) in the presence of amikacin at its MIC. The thickened cell wall can also be observed in an in vitro-induced strain (CY002-AMI(R)) in the presence of amikacin at its MIC (36.78 ± 3.41 nm); this strain was obtained by gradually increasing the amount of amikacin. However, the cell wall-thickened strains cultured in the presence of amikacin are still susceptible to vancomycin. CONCLUSIONS Cell wall thickening is associated with adaptive resistance in MRSA and alternative antibiotics can be used to treat patients when adaptive resistance to amikacin has developed.

Design and expression of peptide antibiotic hPAB-β as tandem multimers in Escherichia coli

Peptide antibiotics are small peptides encoded by organism genomic DNA. They are recognized to play important roles in the innate host defense of most living organisms. The growing resistance of bacteria to conventional antibiotics and the need for discovery of new antibiotics have stimulated great interest in the development of peptide antibiotics as human therapeutics. However, preparation of peptide antibiotics at a large scale is a great challenge in developing these commercial products. In this study, tandem repeat multimers of peptide antibiotic hPAB-beta were designed and the recombinant plasmids containing one to eight copies of hPAB-beta gene were generated. Eight genetic engineered bacteria harboring pQE-hPAB-beta1-8 recombinant were able to express the repetitive hPAB-beta multimers of interest in inclusion bodies, respectively. The expressed proteins could reach 2.6-28% of the total proteins. The hPAB-beta trimer construct was selected out for the subsequent study based on its higher expression level (27.8%), which yields in wet cell weights (3.15+/-0.45 g/l) and the fusion protein inclusion bodies was able to completely dissolve in 8 M urea. The tandem trimers could easily be captured by Ni-NTA affinity chromatography and cleaved into monomers by hydroxylamine. Then, the monomer hPAB-beta of interest was purified to 95% homogeneity by reverse phase chromatography and gel filtration. The final yield of purified recombinant monomer hPAB-beta was 680+/-12 mg/100 g wet cells. The minimum inhibitory concentrations (MICs) of the purified recombinant hPAB-beta against type or clinical strains of microorganisms were about 31-250 microg/ml and these results showed that the recombinant hPAB-beta could retain its bioactivity.

Genetic polymorphisms of molecules involved in host immune response to dengue virus infection

The dengue virus (DENV) belongs to the flavivirus family. Each of the four distinct serotypes of this virus is capable of causing human disease, especially in tropical and subtropical areas. The majority of people infected with DENV manifest asymptomatic or dengue fever with flu-like self-limited symptoms. However, a small portion of patients emerge with severe manifestations referred to as dengue hemorrhagic fever, which has a high mortality rate if not treated promptly. The host immune system, which plays important roles throughout the whole process of DENV infection, has been confirmed to have double-edged effects on DENV infection. Recently, much attention has been paid to the genetic heterogeneity of molecules involved in the host immune response to DENV infection. This heterogeneity has been proved to be the determining factor for DENV disease orientation. The present review discusses the primary functions and single nucleotide polymorphisms of some critical molecules in the human DENV immunological defense, especially the polymorphism locus associated with the DENV pathogenesis and disease susceptibility.

Morganella morganii, a non-negligent opportunistic pathogen

Morganella morganii belongs to the tribe Proteeae of the Enterobacteriaceae family. This species is considered as an unusual opportunistic pathogen that mainly causes post-operative wound and urinary tract infections. However, certain clinical M. morganii isolates present resistance to multiple antibiotics by carrying various resistant genes (such as blaNDM-1, and qnrD1), thereby posing a serious challenge for clinical infection control. Moreover, virulence evolution makes M. morganii an important pathogen. Accumulated data have demonstrated that M. morganii can cause various infections, such as sepsis, abscess, purple urine bag syndrome, chorioamnionitis, and cellulitis. This bacterium often results in a high mortality rate in patients with some infections. M. morganii is considered as a non-negligent opportunistic pathogen because of the increased levels of resistance and virulence. In this review, we summarized the epidemiology of M. morganii, particularly on its resistance profile and resistant genes, as well as the disease spectrum and risk factors for its infection.

Dengue virus-like particles: construction and application

Virus-like particles (VLPs) are shell-like viruses that lack virus-specific genetic materials. Many viral-structured proteins can assemble into VLPs, which mimic the overall structure of virus particles and can elicit strong immune responses in a host. Dengue viruses (DENVs), from the genus Flavivirus, are transmitted to humans through the bites of an infected Aedes mosquito. DENVs cause several diseases that prevailed mainly in tropical and subtropical areas. However, effective treatment measures and preventive strategies for dengue diseases are still lacking. The present minireview summarized the assembly and maturation of DENVs, the strategies and effective factors for dengue VLP construction, and the application of DENV VLPs.