Yinling Tan

Whole genome sequencing of a novel temperate bacteriophage of P. aeruginosa: evidence of tRNA gene mediating integration of the phage genome into the host bacterial chromosome

Whole genome sequencing of a novel Pseudomonas aeruginosa temperate bacteriophage PaP3 has been completed. The genome contains 45 503 bp with GC content of 52.1%, without more than 100 bp sequence hitting homologue in all sequenced phage genomes. A total of 256 open reading frames (ORFs) are found in the genome, and 71 ORFs are predicated as coding sequence (CDS). All 71 CDS are divided into the two opposite direction groups, and both groups meet at the bidirectional terminator site locating the near middle of the genome. The genome is dsDNA with 5′‐protruded cohesive ends and cohesive sequence is ′GCCGGCCCCTTTCCGCGTTA′ (20 mer). There are four tRNA genes (tRNAAsn, tRNAAsp, tRNATyr and tRNAPro) clustering at the 5′‐terminal of the genome. Analysis of integration site of PaP3 in the host bacterial genome confirmed that the core sequence of (GGTCGTAGGTTCGAATCCTAC‐21mer) locates at tRNAPro gene within the attP region and at tRNALys gene in the attB region. The results indicated that 3′‐end of tRNAPro gene of the PaP3 genome is involved in the integration reaction and 5′‐end of tRNALys gene of host bacteria genome is hot spot of the integration.

Mapping the tail fiber as the receptor binding protein responsible for differential host specificity of Pseudomonas aeruginosa bacteriophages PaP1 and JG004.

The first step in bacteriophage infection is recognition and binding to the host receptor, which is mediated by the phage receptor binding protein (RBP). Different RBPs can lead to differential host specificity. In many bacteriophages, such as Escherichia coli and Lactococcal phages, RBPs have been identified as the tail fiber or protruding baseplate proteins. However, the tail fiber-dependent host specificity in Pseudomonas aeruginosa phages has not been well studied. This study aimed to identify and investigate the binding specificity of the RBP of P. aeruginosa phages PaP1 and JG004. These two phages share high DNA sequence homology but exhibit different host specificities. A spontaneous mutant phage was isolated and exhibited broader host range compared with the parental phage JG004. Sequencing of its putative tail fiber and baseplate region indicated a single point mutation in ORF84 (a putative tail fiber gene), which resulted in the replacement of a positively charged lysine (K) by an uncharged asparagine (N). We further demonstrated that the replacement of the tail fiber gene (ORF69) of PaP1 with the corresponding gene from phage JG004 resulted in a recombinant phage that displayed altered host specificity. Our study revealed the tail fiber-dependent host specificity in P. aeruginosa phages and provided an effective tool for its alteration. These contributions may have potential value in phage therapy.

Genomic and Proteomic Analyses of the Terminally Redundant Genome of the Pseudomonas aeruginosa Phage PaP1: Establishment of Genus PaP1-Like Phages

We isolated and characterized a new Pseudomonas aeruginosa myovirus named PaP1. The morphology of this phage was visualized by electron microscopy and its genome sequence and ends were determined. Finally, genomic and proteomic analyses were performed. PaP1 has an icosahedral head with an apex diameter of 68–70 nm and a contractile tail with a length of 138–140 nm. The PaP1 genome is a linear dsDNA molecule containing 91,715 base pairs (bp) with a G+C content of 49.36% and 12 tRNA genes. A strategy to identify the genome ends of PaP1 was designed. The genome has a 1190 bp terminal redundancy. PaP1 has 157 open reading frames (ORFs). Of these, 143 proteins are homologs of known proteins, but only 38 could be functionally identified. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis and high-performance liquid chromatography-mass spectrometry allowed identification of 12 ORFs as structural protein coding genes within the PaP1 genome. Comparative genomic analysis indicated that the Pseudomonas aeruginosa phage PaP1, JG004, PAK_P1 and vB_PaeM_C2-10_Ab1 share great similarity. Besides their similar biological characteristics, the phages contain 123 core genes and have very close phylogenetic relationships, which distinguish them from other known phage genera. We therefore propose that these four phages be classified as PaP1-like phages, a new phage genus of Myoviridae that infects Pseudomonas aeruginosa.

Chromosomal DNA deletion confers phage resistance to Pseudomonas aeruginosa

Bacteria develop a broad range of phage resistance mechanisms, such as prevention of phage adsorption and CRISPR/Cas system, to survive phage predation. In this study, Pseudomonas aeruginosa PA1 strain was infected with lytic phage PaP1, and phage-resistant mutants were selected. A high percentage (~30%) of these mutants displayed red pigmentation phenotype (Red mutant). Through comparative genomic analysis, one Red mutant PA1r was found to have a 219.6 kb genomic fragment deletion, which contains two key genes hmgA and galU related to the observed phenotypes. Deletion of hmgA resulted in the accumulation of a red compound homogentisic acid; while A galU mutant is devoid of O-antigen, which is required for phage adsorption. Intriguingly, while the loss of galU conferred phage resistance, it significantly attenuated PA1r in a mouse infection experiment. Our study revealed a novel phage resistance mechanism via chromosomal DNA deletion in P. aeruginosa.

Design and expression of peptide antibiotic hPAB-β as tandem multimers in Escherichia coli

Peptide antibiotics are small peptides encoded by organism genomic DNA. They are recognized to play important roles in the innate host defense of most living organisms. The growing resistance of bacteria to conventional antibiotics and the need for discovery of new antibiotics have stimulated great interest in the development of peptide antibiotics as human therapeutics. However, preparation of peptide antibiotics at a large scale is a great challenge in developing these commercial products. In this study, tandem repeat multimers of peptide antibiotic hPAB-beta were designed and the recombinant plasmids containing one to eight copies of hPAB-beta gene were generated. Eight genetic engineered bacteria harboring pQE-hPAB-beta1-8 recombinant were able to express the repetitive hPAB-beta multimers of interest in inclusion bodies, respectively. The expressed proteins could reach 2.6-28% of the total proteins. The hPAB-beta trimer construct was selected out for the subsequent study based on its higher expression level (27.8%), which yields in wet cell weights (3.15+/-0.45 g/l) and the fusion protein inclusion bodies was able to completely dissolve in 8 M urea. The tandem trimers could easily be captured by Ni-NTA affinity chromatography and cleaved into monomers by hydroxylamine. Then, the monomer hPAB-beta of interest was purified to 95% homogeneity by reverse phase chromatography and gel filtration. The final yield of purified recombinant monomer hPAB-beta was 680+/-12 mg/100 g wet cells. The minimum inhibitory concentrations (MICs) of the purified recombinant hPAB-beta against type or clinical strains of microorganisms were about 31-250 microg/ml and these results showed that the recombinant hPAB-beta could retain its bioactivity.

Anti-obesity Effect of Capsaicin in Mice Fed with High-Fat Diet Is Associated with an Increase in Population of the Gut Bacterium Akkermansia muciniphila

Capsaicin (CAP) reduces body weight mainly through activation of transient receptor potential vanilloid 1 (TRPV1) cation channel. However, recent evidence indicates that the gut microbiota influences many physiological processes in host and might provoke obesity. This study determined whether the anti-obesity effect of CAP is related to the changes in gut microbiota. C57BL/6 mice were fed either with high-fat diet (HFD) or HFD with CAP (HFD-CAP) for 9 weeks. We observed a significantly reduced weight gain and improved glucose tolerance in HFD-CAP-fed mice compared with HFD-fed mice. 16S rRNA gene sequencing results showed a decrease of phylum Proteobacteria in HFD-CAP-fed mice. In addition, HFD-CAP-fed mice showed a higher abundance of Akkermansia muciniphila, a mucin-degrading bacterium with beneficial effects on host metabolism. Further studies found that CAP directly up-regulates the expression of Mucin 2 gene Muc2 and antimicrobial protein gene Reg3g in the intestine. These data suggest that the anti-obesity effect of CAP is associated with a modest modulation of the gut microbiota.

Global Transcriptomic Analysis of Interactions between Pseudomonas aeruginosa and Bacteriophage PaP3.

The interactions between Bacteriophage (phage) and host bacteria are widespread in nature and influences of phage replication on the host cells are complex and extensive. Here, we investigate genome-wide interactions of Pseudomonas aeruginosa (P. aeruginosa) and its temperate phage PaP3 at five time points during phage infection. Compared to the uninfected host, 38% (2160/5633) genes of phage-infected host were identified as differentially expressed genes (DEGs). Functional analysis of the repressed DEGs revealed infection-stage-dependent pathway communications. Based on gene co-expression analysis, most PaP3 middle genes were predicted to have negative impact on host transcriptional regulators. Sub-network enrichment analysis revealed that adjacent genes of PaP3 interacted with the same host genes and might possess similar functions. Finally, our results suggested that during the whole infection stage, the early genes of PaP3 had stronger regulatory role in host gene expression than middle and late genes, while the host genes involved amino acid metabolism were the most “vulnerable” targets of these phage genes. This work provides the basis for understanding survival mechanisms of parasites and host, and seeking phage gene products that could potentially be used in anti-bacterial infection.

Identification of lytic bacteriophage MmP1, assigned to a new member of T7-like phages infecting Morganella morganii

MmP1 (Morganella morganii phage 1) is a lytic bacteriophage newly isolated from the host bacterium M. morganii. The entire genome was sequenced, and final assembly yielded a 38,234bp linear double-stranded DNA (dsDNA) with a G+C content of 46.5%. In the MmP1 genome, 49 putative genes, 10 putative promoters and 2 predicted sigma-independent terminators were determined through bioinformatic analysis. A striking feature of the MmP1 genome is its high degree of similarity to the T7 group of phages. All of the 49 predicted genes exist on the same DNA strand, and functions were assigned to 35 genes based on the similarity of the homologues deposited in GenBank, which share 30-80% identity to their counterparts in T7-like phages. The analyses of MmP1 using CoreGenes, phylogenetic tree of RNA polymerase and structural proteins have demonstrated that bacteriophage MmP1 should be assigned as a new member of T7-like phages but as a relatively distant member of this family. This is the first report that a T7-like phage adaptively parasitizes in M. morganii, and this will advance our understanding of biodiversity and adaptive evolution of T7-like phages.

Identification and Characterization of the HicAB Toxin-Antitoxin System in the Opportunistic Pathogen Pseudomonas aeruginosa

Toxin-antitoxin (TA) systems are small genetic modules that are widely distributed in the genomes of bacteria and archaea and have been proposed to fulfill numerous functions. Here, we describe the identification and characterization of a type II TA system, comprising the hicAB locus in the human opportunistic pathogen Pseudomonas aeruginosa. The hicAB locus consists of genes hicA and hicB encoding a toxin and its cognate antitoxin, respectively. BLAST analysis revealed that hicAB is prevalent in approximately 36% of P. aeruginosa strains and locates in the same genomic region. RT-PCR demonstrated that hicAB forms a bicistronic operon that is cotranscribed under normal growth conditions. Overproduction of HicA inhibited the growth of Escherichia coli, and this effect could be counteracted by co-expression of HicB. The Escherichia coli kill/rescue assay showed that the effect of HicA is bacteriostatic, rather than bactericidal. Deletion of hicAB had no effect on the biofilm formation and virulence of P. aeruginosa in a mice infection model. Collectively, this study presents the first characterization of the HicAB system in the opportunistic pathogen P. aeruginosa.

The chromosomal SezAT toxin–antitoxin system promotes the maintenance of the SsPI‐1 pathogenicity island in epidemic Streptococcus suis

Streptococcus suis has emerged as a causative agent of human meningitis and streptococcal toxic shock syndrome over the last years. The high pathogenicity of S. suis may be due in part to a laterally acquired pathogenicity island (renamed SsPI‐1), which can spontaneously excise and transfer to recipients. Cells harboring excised SsPI‐1 can potentially lose this island if cell division occurs prior to its reintegration; however, attempts to cure SsPI‐1 from the host cells have been unsuccessful. Here, we report that an SsPI‐1‐borne Epsilon/Zeta toxin–antitoxin system (designated SezAT) promotes SsPI‐1 stability in bacterial populations. The sezAT locus consists of two closely linked sezT and sezA genes encoding a toxin and its cognate antitoxin, respectively. Overproduction of SezT induces a bactericidal effect that can be neutralized by co‐expression of SezA, but not by its later action. When devoid of a functional SezAT system, large‐scale deletion of SsPI‐1 is straightforward. Thus, SezAT serves to ensure inheritance of SsPI‐1 during cell division, which may explain the persistence of epidemic S. suis. This report presents the first functional characterization of TA loci in S. suis, and the first biochemical evidence for the adaptive significance of the Epsilon/Zeta system in the evolution of pathogen virulence.