Marcella Martinelli

Strong Evidence of Linkage Disequilibrium between Polymorphisms at the IRF6 Locus and Nonsyndromic Cleft Lip With or Without Cleft Palate, in an Italian Population

Cleft lip with or without cleft palate (CL/P) is one of the most common birth defects, but its etiology is largely unknown. It is very likely that both genetic and environmental factors contribute to this malformation. Mutations in the gene for interferon regulatory factor 6 (IRF6) have been shown to be the cause of Van der Woude syndrome, a dominant disorder that has CL/P as a common feature. Recently, it has been reported that genetic polymorphisms at the IRF6 locus are associated with nonsyndromic CL/P, with stronger association in Asian and South American populations. We investigated four markers spanning the IRF6 locus, using the transmission/disequilibrium test. A sample of 219 Italian triads of patients and their parents were enrolled in the study. Strong evidence of linkage disequilibrium was found between markers and disease in both single-allele (P=.002 at marker rs2235375) and haplotype (P=.0005) analyses. These findings confirm the contribution of IRF6 in the etiology of nonsyndromic CL/P and strongly support its involvement in populations of European ancestry.

Src-dependent ERK5 and Src/EGFR-dependent ERK1/2 activation is required for cell proliferation by asbestos.

Crocidolite asbestos elicits oxidative stress and cell proliferation, but the signaling cascades linked to these outcomes are unclear. To determine the role of mitogen-activated protein kinases (MAPK) in asbestos-induced cell signaling, we evaluated the effects of crocidolite asbestos, EGF and H2O2, on MAPK activation in murine lung epithelial cells (C10 line). In contrast to rapid and transient activation of extracellular signal-regulated kinase 5 (ERK5) by EGF or H2O2, asbestos caused protracted oxidant-dependent ERK5 activation that was inhibited by an Src kinase inhibitor (PP2), but not by an inhibitor of epidermal growth factor receptor (EGFR) phosphorylation (AG1478). ERK1/2 activation by asbestos was inhibited by either PP2 or AG1478. To confirm the involvement of Src in ERK1/2 and ERK5 activation, a dominant-negative Src construct was used. These experiments showed that Src was essential for ERK1/2and also ERK5 phosphorylation by asbestos. Time frame studies indicated immediate activation of Src by asbestos fibers, whereas EGFR phosphorylation occurred subsequently. Data suggest that asbestos causes activation of ERK5 through an EGFR-independent pathway, whereas ERK1/2 activation is dependent on Src through a mechanism involving phosphorylation of the EGFR. Furthermore, Src, ERK1/2 and ERK5 activation are essential for cell proliferation by asbestos. The use of a dominant-negative ERK5 construct caused selective downregulation of c-jun expression, whereas inhibition of Src by PP2 or MEK1 by PD98059 caused decreases in c-fos, fra-1 and c-jun expression in asbestos-exposed C10 cells. These observations may have broad relevance to cell proliferation by carcinogenic mineral fibers and oxidants.

Investigation of the W185X nonsense mutation of PVRL1 gene in Italian nonsyndromic cleft lip and palate patients

Nonsyndromic cleft lip with or without cleft palate (CL/P; MIM 119530), a common birth defect, is a genetically complex trait. Several genetic and environmental factors seem to be involved in the development of this malformation [Carinci et al., 2003]. Nevertheless, CL/P also occurs as a part of many single gene syndromes, and some of these genes may also have roles in nonsyndromic CL/P. Suzuki et al. [2000] showed that the rareautosomal recessive syndromeCL/P-ectodermal dysplasia (CLPED1;MIM 225060) is caused by the loss-of-function ofPVRL1 gene, which encodes nectin-1, a cell-to-cell adhesion molecule. The same group demonstrated that heterozygosity of the nonsense mutation W185X is a genetic risk factor for nonsyndromic CL/P in northern Venezuela [Sozen et al., 2001]. To verify whether the W185X mutation is a genetic risk factor for nonsyndromic CL/P in the Italian population, 71 familial CL/P belonging to 71 different pedigrees, 75 sporadic CL/P, and 100 unrelated unaffected individuals were enrolled in this study. The W185X mutation is a singlenucleotide change G!A that creates a StyI restriction endonuclease site. Therefore, a 160 bp segment of the exon 3 containing the mutation was amplified by PCR using the following primers: W185X.for 50CCACCAATTGGATAGAGGGTA30 and W185X.rev 50CGGATCTCCTGGTACTCTGC30. Amplimers were digested with StyI restriction endonuclease, electrophoresed on 2.5% agarose gel, and visualized by ethidium bromide. Positive controls, containing the mutation generated by site-directed mutagenesis (www.buckinstitute.org/benz/prot/prot12.htm), were included to verify the assay efficiency in each test. Of the 146 CL/P patients and of the 100 unaffected individuals analyzed in this study for the presence of the W185X mutation in the PVRL1 exon 3, none was positive. The results of this investigation indicate that in Italy the W185X mutation is not common and in turn, it does not constitutea risk factor fornonsyndromicCL/P.As suggestedby Suzuki et al. [2000], since the PVRL1 gene product constitutes a receptor for herpesviruses, in the Margarita Island population the mutation may be selected positively for an increased resistance to infections of the carriers. Our findings significantly differ from those previously observed in the Venezuelan population [Sozen et al., 2001]. This discrepancy likely reflects the complex etiology of the CL/P malformation. Indeed, the numerous genetic and environmental factors involved probably contribute differently to the development of the malformation in distinct populations. REFERENCES

Expression profiling of ameloblastic carcinoma.

Ameloblastic carcinoma (AC) is a malignant epithelial odontogenic tumor that histologically retains the features of ameloblastic differentiation and exhibits cytological features of malignancy in the primary or recurrent tumor. It may develop within a preexisting ameloblastoma or arise de novo or from an odontogenic cyst. Expression profiling by DNA microarray is a new molecular technology that allows the analysis of cell and tissue gene expression. By using DNA microarrays containing 19,200 genes, several genes whose expression was significantly upregulated or downregulated were identified in a case of AC. The differentially expressed genes cover a broad range of functional activities: 1) transcription, 2) signaling transduction, 3) cell cycle regulation, 4) apoptosis control, and 5) differentiation. The data reported are, to our knowledge, the first genetic portrait of an AC. No final conclusion can be drawn; however, this portrait will be useful in investigating the biological behavior and in identifying possible gene targets for cancer therapy when more cases of this rare tumor are reported and compared.

Papilloma and Polyoma DNA Tumor Virus Sequences in Female Genital Tumors

Human papillomaviruses (HPVs) and BKV, JCV, and SV40 polyomaviruses (PYVs) are oncogenic viruses associated with different human tumors. Our aim was to determine if PYV and HPV sequences could be detected in human genital tumors. HPV types 6b, 11, 16, and 18 and PYV were investigated in 22 genital tumor samples and the corresponding adjacent normal tissues, by PCR and filter hybridization. HPV and PYV sequences were also searched in six sperm fluid and four peripheral blood cell (PBC) samples. HPV-16 sequences were revealed in 7 of 14 cervical tumors and 1 of 1 vaginal adenocarcinoma, whereas 1 of 14 cervical carcinoma tested positive for HPV-18. Interestingly, each normal cervical tissue surrounding the neoplasm obtained from the same patient was positive for HPV type-16 and -18 with the same prevalence detected in tumors. BKV sequences were found in 9 of 14 cervical tumors, 1 of 7 vulvar tumors, and 1 of 1 adenocarcinoma, but also in normal tissues from cervix (13 of 14), vulva (6 of 7), sperm fluid (5 of 6) and PBC (3 of 4) samples. SV40 sequences were detected in 1 of 14 normal cervical tissue, 2 of 6 sperm fluids and 1 of 4 PBCs. None of the samples were JCV positive. To our knowledge, this is the first investigation reporting on the simultaneous association of both HPV and PYV with human genital tumors. These results suggest that PYV, together with HPV, may be involved as a cofactor in the onset/progression of human genital tumors, and raise the possibility that PYV act synergistically with HPV to enhance their pathogenicity in vivo. In addition, HPV and PYV may complement each other in infecting human genital tissues.

Asbestos-Induced Mesothelioma

Asbestos, a group of chemically and physically distinct fibers, is one of the most notorious carcinogens in the lung and pleura. The National Institutes of Health in 1978 estimated that approximately 11 million individuals had been exposed to asbestos in the United States since 1940 (1). Although widely employed in World Wars I and II, the use of asbestos has undergone major changes in recent decades, with severe restrictions in most countries on amphiboles. In developed countries, with the exception of Japan, asbestos production is controlled or banned, while in developing countries, consumption has leveled off or increased (2). Between the 1940s and 1970s, asbestos was utilized extensively in insulation applications (primarily in the building construction industry), and in asbestos-cement pipes. Current usage is generally confined to chrysotile in four products: asbestos cement, friction materials, roof coating and cements, and gaskets. In 1992 approximately 28 million tons of asbestos-cement products were produced in approximately 100 countries (3).