G. Ravikanth

Endophytic fungal strains of Fusarium solani, from Apodytes dimidiata E. Mey. ex Arn (Icacinaceae) produce camptothecin, 10-hydroxycamptothecin and 9-methoxycamptothecin

Camptothecin and 10-hydroxycamptothecin are two important precursors for the synthesis of the clinically useful anticancer drugs, topotecan and irinotecan. In recent years, efforts have been made to identify novel plant and endophytic fungal sources of camptothecin and 10-hydroxycamptothecin. In this study we have isolated endophytic fungi strains from Apodytes dimidiata (Icacinaceae), a medium sized tree from the Western Ghats, India. The fungi were identified as Fusarium solani using both ITS rDNA sequencing and spore morphology. Two strains, MTCC 9667 and MTCC 9668 were isolated, both of which produced camptothecin and 9-methoxycamptothecin in their mycelia; one of the strains, MTCC 9668 also produced 10-hydroxycamptothecin, though in small amounts. The yields of camptothecin in MTCC 9667 and MTCC 9668 were 37 and 53 microg/100g, respectively, after 4 days of incubation in broth culture. The yields of 10-hydroxycamptothecin and 9-methoxycamptothecin in MTCC 9668 were 8.2 and 44.9 microg/100g, respectively. Further research in optimizing the culture conditions of these fungal strains might permit their application for the production of camptothecin and 10-hydroxycamptothecin.

Assessing species admixtures in raw drug trade of Phyllanthus, a hepato-protective plant using molecular tools

ETHNOPHARMACOLOGICAL RELEVANCEnPhyllanthus (Euphorbiaceae) species are well known for their hepato-protective activity and are used in several ethno-medicines in indigenous health care systems in India.nnnAIM OF THE STUDYnTo assess species admixtures in raw drug trade of Phyllanthus using morphological and DNA barcoding tools.nnnMATERIALS AND METHODSnSamples of Phyllanthus used in raw drug trade were obtained from 25 shops in southern India. Species admixtures in the samples were assessed by identifying species using morpho-taxonomic keys. These identities were further validated by developing species specific DNA barcode signatures using the chloroplast DNA region, psbA-trnH. DNA from the market samples were extracted and amplified using the forward (psbAF - GTTATGCATGAACGTAATGCTC) and reverse primer (trnHR - CGCGCATGGTGGATTCACAAATC). The amplified products were sequenced at Chromous Biotech India, Bangalore. The sequences were manually edited using Chromas Lite. Species identities were established by constructing a neighbor-joining tree using MEGA V 4.0.nnnRESULTSnMorphological analysis of market samples revealed six different species of Phyllanthus in the trade samples. Seventy-six percent of the market samples contained Phyllanthus amarus as the predominant species (>95%) and thus were devoid of admixtures. The remaining 24% of the shops had five different species of Phyllanthus namely Phyllanthus debilis, Phyllanthus fraternus, Phyllanthus urinaria, Phyllanthus maderaspatensis, and Phyllanthus kozhikodianus. All identities, except those for Phyllanthus fraternus, were further confirmed by the species specific DNA barcode using chloroplast region psbA-trnH.nnnCONCLUSIONnOur results show that market samples of Phyllanthus sold in southern India contain at least six different species, though among them, Phyllanthus amarus is predominant. DNA barcode, psbA-trnH region of the chloroplast can effectively discriminate Phyllanthus species and hence can be used to resolve species admixtures in the raw drug trade of Phyllanthus.

Fusarium proliferatum, an endophytic fungus from Dysoxylum binectariferum Hook.f, produces rohitukine, a chromane alkaloid possessing anti-cancer activity

Rohitukine is a chromane alkaloid possessing anti-inflammatory, anti-cancer and immuno-modulatory properties. The compound was first reported from Amoora rohituka (Meliaceae) and later from Dysoxylum binectariferum (Meliaceae) and Schumanniophyton problematicum (Rubiaceae). Flavopiridol, a semi-synthetic derivative of rohitukine is a potent CDK inhibitor and is currently in Phase III clinical trials. In this study, the isolation of an endophytic fungus, Fusarium proliferatum (MTCC 9690) from the inner bark tissue of Dysoxylum binectariferum Hook.f (Meliaceae) is reported. The endophytic fungus produces rohitukine when cultured in shake flasks containing potato dextrose broth. The yield of rohitukine was 186xa0μg/100xa0g dry mycelial weight, substantially lower than that produced by the host tissue. The compound from the fungus was authenticated by comparing the LC–HRMS and LC–HRMS/MS spectra with those of the reference standard and that produced by the host plant. Methanolic extract of the fungus was cytotoxic against HCT-116 and MCF-7 human cancer cell lines (IC50xa0=xa010xa0μg/ml for both cancer cell lines).

Endophytic fungi from Miquelia dentata Bedd., produce the anti-cancer alkaloid, camptothecine

Camptothecine (Campothecin, CPT), a quinoline alkaloid, is a potent inhibitor of eukaryotic topoisomerase I. Several semi-synthetic derivatives of CPT are in clinical use against ovarian, small lung and refractory ovarian cancers. While CPT is produced by several plant species belonging to the Asterid clade, in recent years, efforts have been made to isolate endophytic fungi from some of these plants as possible alternative sources of CPT. In this study we report the isolation of three endophytic fungi from fruit and seed regions of Miquelia dentata (Icacinaceae), that produce CPT, 9-methoxy CPT (9-MeO-CPT) and 10-hydroxy CPT (10-OH-CPT). All the three fungi identified as, Fomitopsis sp. P. Karst (MTCC 10177), Alternaria alternata (Fr.) Keissl (MTCC 5477) and Phomposis sp. (Sacc.) produced CPT, 9-MeO-CPT and 10-OH-CPT in mycelial mats in shake flasks containing potato dextrose broth. Methanolic and ethyl acetate extracts of these fungal species were cytotoxic to colon and breast cancer cell lines. We discuss these results in the context of the recent interest in endophytic fungi as possible alternative sources of plant secondary metabolites.

Assessing product adulteration in natural health products for laxative yielding plants, Cassia, Senna, and Chamaecrista, in Southern India using DNA barcoding

Medicinal plants such as Cassia, Senna, and Chamaecrista (belonging to the family Fabaceae) are well known for their laxative properties. They are extensively used within indigenous health care systems in India and several other countries. India exports over 5000 metric tonnes per year of these specific herbal products, and the demand for natural health product market is growing at approximately 10–15xa0% annually. The raw plant material used as active ingredients is almost exclusively sourced from wild populations. Consequently, it is widely suspected that the commercial herbal products claiming to contain these species may be adulterated or contaminated. In this study, we have attempted to assess product authentication and the extent of adulteration in the herbal trade of these species using DNA barcoding. Our method includes four common DNA barcode regions: ITS, matK, rbcL, and psbA-trnH. Analysis of market samples revealed considerable adulteration of herbal products: 50xa0% in the case of Senna auriculata, 37xa0% in Senna tora, and 8xa0% in Senna alexandrina. All herbal products containing Cassia fistula were authentic, while the species under the genus Chamaecrista were not in trade. Our results confirm the suspicion that there is rampant herbal product adulteration in Indian markets. DNA barcodes such as that demonstrated in this study could be effectively used as a regulatory tool to control the adulteration of herbal products and contribute to restoring quality assurance and consumer confidence in natural health products.

Dysoxylum binectariferum Hook.f (Meliaceae), a rich source of rohitukine

Rohitukine, a chromane alkaloid, is a precursor of flavopiridol, a promising anti-cancer compound. Currently in Phase III clinical trials, flavopiridol is a potent inhibitor of several cyclin-dependent kinases (CDKs). Rohitukine was first reported from Amoora rohituka (0.083% dry weight) followed by that in Dysoxylum binectariferum (0.9% dry weight), both belonging to the family Meliaceae. Here, we report incredibly high yields of rohitukine (7% dry weight) in trees of D. binectariferum from the Western Ghats, India. Crude extracts of the tree were found to be highly effective against ovarian and breast cancer lines tested.

Ambient ionization mass spectrometry imaging of rohitukine, a chromone anti-cancer alkaloid, during seed development in Dysoxylum binectariferum Hook.f (Meliaceae)

Rohitukine, a chromone alkaloid, possesses anti-inflammatory, anti-cancer and immuno-modulatory properties. It has been reported from four species, belonging to the families, Meliaceae and Rubiaceae. Stem bark of Dysoxylum binectariferum (Meliaceae) accumulates the highest amount of rohitukine (3-7% by dry weight). In this study, we examine the spatial and temporal distribution of rohitukine and related compounds during various stages of seed development in D. binectariferum using desorption electrospray ionization mass spectrometry imaging (DESI MSI). Rohitukine (m/z 306.2) accumulation increased from early seed development to seed maturity stage. The spatial distribution of rohitukine was largely restricted to the cotyledonary tissue followed by the embryo and least in the seed coat. Besides rohitukine, rohitukine acetate (m/z 348.2) and glycosylated rohitukine (m/z 468.2) were also detected, both through mass fragmentation and exact mass analysis through Orbitrap mass spectrometry. These results indicate a dynamic pattern of chromane alkaloid accumulation through seed development in D. binectariferum.

New plant sources of the anti-cancer alkaloid, camptothecine from the Icacinaceae taxa, India

In this study, the production of camptothecine and its derivatives, in thirteen species of the family Icacinaceae, namely, Apodytes dimidiata, Codiocarpus andamanicus, Gomphandra comosa, Gomphandra coriacea, Gomphandra polymorpha, Gomphandra tetrandra, Iodes cirrhosa, Iodes hookeriana, Miquelia dentata, Miquelia kleinii, Natsiatum herpeticum, Pyrenacantha volubilis and Sarcostigma kleinii is reported. Seeds of M. dentata were found to produce the highest content of camptothecine (1.0-1.4% by dry weight of seeds). Full scan LC-MS and ESI-MS/MS analysis of M. dentata revealed, besides camptothecine, a number of other derivatives, namely, 10-hydroxycamptothecine, 9-methoxycamptothecine, 20-deoxycamptothecine. Crude extract preparations of the seeds of M. dentata were effective against a breast cancer cell line (IC50=3.82 μg/ml for MDA MB273 cell lines) and two ovarian cancer cell lines (IC50=2.8 μg/ml for NCI/ADR-RES and 4.5 μg/ml for SKOV). These results are the first reports of camptothecine and its derivatives in these species and offer rich alternative plant sources for the anticancer compound, camptothecine.

Chemical Profiling of Nothapodytes nimmoniana for Camptothecin, an Important Anticancer Alkaloid: Towards the Development of a Sustainable Production System

Camptothecin (CPT), a pyrrolo quinoline alkaloid, is one of the most promising anticancer drugs of the 21st century. The compound was first isolated from the Chinese deciduous tree, Camptotheca acuminata. CPT exhibits a broad spectrum of antitumor activity both under in vitro and in vivo conditions. Irinotecan (CPT11) and Topotecan (TPT), two water-soluble derivatives of CPT, have been approved by the United States Food and Drug Administration for treating colorectal and ovarian cancers as well as against several types of brain tumor in children. Although CPT has been reported to exist in several species, the highest concentration (about 0.3 %) to date has been realized from Nothapodytes nimmoniana. The tree commonly referred to as “stinking tree” is native to warmer regions of South India. In the last few decades, driven by the enormous demand for CPT, there has been a decline of at least 20 % in the population, leading to red listing of the species. In recent years, efforts have been initiated in India to identify high-yielding individuals and populations of N. nimmoniana in its natural distribution range with the ultimate aim of using these lines to develop clonal orchards, as well as in developing in vitro production systems.In this chapter, we briefly review the overall status of N. nimmoniana as a source of CPT. Drawing upon existing literature as well as ongoing work at our laboratory, we discuss the basic patterns of accumulation of CPT in N. nimmoniana. We review the population variability for CPT accumulation along the distributional range of the species in the Western Ghats, India. Using a relatively new tool, namely the ecological niche model, we predict the chemical hot-spots of the species in the Western Ghats and offer a test of this prediction. Finally, we discuss strategies for a sustainable model of extraction of CPT from N. nimmoniana.

Genetic structure and demographic history of the endangered tree species Dysoxylum malabaricum (Meliaceae) in Western Ghats, India: implications for conservation in a biodiversity hotspot.

The impact of fragmentation by human activities on genetic diversity of forest trees is an important concern in forest conservation, especially in tropical forests. Dysoxylum malabaricum (white cedar) is an economically important tree species, endemic to the Western Ghats, India, one of the worlds eight most important biodiversity hotspots. As D. malabaricum is under pressure of disturbance and fragmentation together with overharvesting, conservation efforts are required in this species. In this study, range-wide genetic structure of twelve D. malabaricum populations was evaluated to assess the impact of human activities on genetic diversity and infer the species’ evolutionary history, using both nuclear and chloroplast (cp) DNA simple sequence repeats (SSR). As genetic diversity and population structure did not differ among seedling, juvenile and adult age classes, reproductive success among the old-growth trees and long distance seed dispersal by hornbills were suggested to contribute to maintain genetic diversity. The fixation index (FIS) was significantly correlated with latitude, with a higher level of inbreeding in the northern populations, possibly reflecting a more severe ecosystem disturbance in those populations. Both nuclear and cpSSRs revealed northern and southern genetic groups with some discordance of their distributions; however, they did not correlate with any of the two geographic gaps known as genetic barriers to animals. Approximate Bayesian computation-based inference from nuclear SSRs suggested that population divergence occurred before the last glacial maximum. Finally we discussed the implications of these results, in particular the presence of a clear pattern of historical genetic subdivision, on conservation policies.