R. Uma Shaanker

Endophytic fungal strains of Fusarium solani, from Apodytes dimidiata E. Mey. ex Arn (Icacinaceae) produce camptothecin, 10-hydroxycamptothecin and 9-methoxycamptothecin

Camptothecin and 10-hydroxycamptothecin are two important precursors for the synthesis of the clinically useful anticancer drugs, topotecan and irinotecan. In recent years, efforts have been made to identify novel plant and endophytic fungal sources of camptothecin and 10-hydroxycamptothecin. In this study we have isolated endophytic fungi strains from Apodytes dimidiata (Icacinaceae), a medium sized tree from the Western Ghats, India. The fungi were identified as Fusarium solani using both ITS rDNA sequencing and spore morphology. Two strains, MTCC 9667 and MTCC 9668 were isolated, both of which produced camptothecin and 9-methoxycamptothecin in their mycelia; one of the strains, MTCC 9668 also produced 10-hydroxycamptothecin, though in small amounts. The yields of camptothecin in MTCC 9667 and MTCC 9668 were 37 and 53 microg/100g, respectively, after 4 days of incubation in broth culture. The yields of 10-hydroxycamptothecin and 9-methoxycamptothecin in MTCC 9668 were 8.2 and 44.9 microg/100g, respectively. Further research in optimizing the culture conditions of these fungal strains might permit their application for the production of camptothecin and 10-hydroxycamptothecin.

Extraction of non-timber forest products in the forests of Biligiri Rangan Hills, India. 2. Impact of NTFP extraction on regeneration, population structure, and species composition

Sustainable extraction of non-timber forest products (NTFPs) has recently gained considerable attention as a means to enhance rural incomes and conserve tropical forests. However, there is little information on the amounts of products collected per unit area and the impact of extraction on forest structure and composition. In this paper we estimate the quantities of selected products gathered by the Soligas, the indigenous people in the Biligiri Rangaswamy Temple (BRT) sanctuary in Karnataka, India, and examine the effect of extraction on forest structure and composition. Two sites, distant (DS) and proximal (PS), were identified based on the proximity to a Soliga settlement. The frequency of different size classes indicates that regeneration overall is poor in the area. The two sites show differences in species richness, basal area, and tree mortality. Furthermore, non-timber forest product species show a greater deficit of small size classes than the timber forest species, suggesting that regeneration is affected by collection of seeds and fruits from non-timber forest product species. Regeneration, however, may also be affected by other anthropogenic pressures such as fire, grazing and competition with weeds.RésuméA exploração sustentavel de produtos forestais não madereiros tern ganho recentemente considardvel atencao como um meio de aumentar a renda rural e conservar florestas tropicals. No entanto, existem poucas informações sobre a relacao entre quantidade de produtos coletados e impacto da extração na estrutura e composicdo dafloresta. Duas áreas de pesquisa, distal (DS) e proximal (PS), foram selecionadas de acordo com suas proximidades com uma tribo de Soligas. A frequencia de diferentes classes de tamanho de planta indica que a regeneragao de uma forma geral é baixa. Ambas as areas mostraram diferencas em riqueza de espécies, área basal e mortalidade de árvores. Além disso, espécies cuja madeira é explorada possuem um menor déficit no estágio de plántula do que espécies cujos frutos e sementes são explorados. Isto sugere que a exploração de sementes e frutos afeta a regeneração. No entanto, a regeneração pode também ser afetada por pressão antropogénica, tais como: fogo, pastagem e competição com ervas daninhas.

Livelihood gains and ecological costs of non-timber forest product dependence: assessing the roles of dependence, ecological knowledge and market structure in three contrasting human and ecological settings in south India

Non-timber forest products (NTFPs) constitute the single largest determinant of livelihoods for scores of forest fringe communities and poor people in the tropics. In India over 50 million people are believed to be directly dependent upon NTFPs for their subsistence. However, such human dependence on NTFPs for livelihood gains (win) has most frequently been at a certain ecological cost (lose). If livelihoods are to be maintained, the existing ‘win-lose’ settings have to be steered to a ‘win-win’ mode, otherwise, there could be severe erosion of the biological resources and loss of livelihoods (‘lose-lose’). Examining the dependence of forest fringe communities on NTFPs at three sites in south India with contrasting human and ecological settings, three key factors (extent of dependence on NTFPs, indigenous ecological knowledge and market organization) are likely to constrain reaching the win-win situation. How these factors shape the ecological cost of harvesting NTFPs at the three sites is examined. Within the parameter space of these factors, it is possible to predict outcomes and associations that will conform to win-win or win-lose situations. Empirical data derived from the three study sites demonstrate the causality of the observed associations. The key for long-term livelihood gains lies in reducing the ecological cost. Certain interventions and recommendations that could optimize the balance between livelihood gains and ecological cost are proposed.

Assessing species admixtures in raw drug trade of Phyllanthus, a hepato-protective plant using molecular tools

ETHNOPHARMACOLOGICAL RELEVANCE Phyllanthus (Euphorbiaceae) species are well known for their hepato-protective activity and are used in several ethno-medicines in indigenous health care systems in India. AIM OF THE STUDY To assess species admixtures in raw drug trade of Phyllanthus using morphological and DNA barcoding tools. MATERIALS AND METHODS Samples of Phyllanthus used in raw drug trade were obtained from 25 shops in southern India. Species admixtures in the samples were assessed by identifying species using morpho-taxonomic keys. These identities were further validated by developing species specific DNA barcode signatures using the chloroplast DNA region, psbA-trnH. DNA from the market samples were extracted and amplified using the forward (psbAF - GTTATGCATGAACGTAATGCTC) and reverse primer (trnHR - CGCGCATGGTGGATTCACAAATC). The amplified products were sequenced at Chromous Biotech India, Bangalore. The sequences were manually edited using Chromas Lite. Species identities were established by constructing a neighbor-joining tree using MEGA V 4.0. RESULTS Morphological analysis of market samples revealed six different species of Phyllanthus in the trade samples. Seventy-six percent of the market samples contained Phyllanthus amarus as the predominant species (>95%) and thus were devoid of admixtures. The remaining 24% of the shops had five different species of Phyllanthus namely Phyllanthus debilis, Phyllanthus fraternus, Phyllanthus urinaria, Phyllanthus maderaspatensis, and Phyllanthus kozhikodianus. All identities, except those for Phyllanthus fraternus, were further confirmed by the species specific DNA barcode using chloroplast region psbA-trnH. CONCLUSION Our results show that market samples of Phyllanthus sold in southern India contain at least six different species, though among them, Phyllanthus amarus is predominant. DNA barcode, psbA-trnH region of the chloroplast can effectively discriminate Phyllanthus species and hence can be used to resolve species admixtures in the raw drug trade of Phyllanthus.

The Use of Traditional Ecological Knowledge in Forest Management: an Example from India

Many forest communities possess considerable knowledge of the natural resources they use. Such knowledge can potentially inform scientific approaches to management, either as a source of baseline data to fill information gaps that cannot otherwise be addressed or to provide alternative management approaches from which scientists and managers might learn. In general, however, little attention has been given to the relevance of quantitative forms of such knowledge for resource management. Much discussion has focused on the integration of traditional ecological knowledge (TEK) into management, but less attention has been paid to identifying specific areas where it is most useful and where it may be most problematic. We contrasted scientific data with information from TEK in the context of a threat to the sustainable harvesting of a nontimber forest product (NTFP) of livelihood importance in southern India, specifically, a fruit tree infected by mistletoe. The efficiency of deriving information from NTFP harvesters compared to scientific field studies was assessed. We further evaluated the potential of TEK to provide novel solutions to the management problem in question, the degree to which TEK could provide quantitative information, and the biases that might be associated with information derived from TEK. TEK complemented previously gathered ecological data by providing concordant and additional information, but also contradicted some results obtained using a scientific approach. TEK also gave a longer-term perspective with regard to NTFP harvesting patterns. Combining information on historical and current harvesting trends for the NTFP with official data suggests that current assessments of sustainability may be inaccurate and that the use of diverse information sources may provide an effective approach to assessing the status of harvested resources.

Seed abortion in wind-dispersed pods of Dalbergia sissoo: maternal regulation or sibling rivalry?

SummaryDalbergia sissoo, a wind-dispersed tropical tree, shows a positively skewed distribution of seeds per pod. This is attributed to the enhanced dispersal advantage of few-seeded pods due to their reduced wing loading (ratio of weight to pod surface area) and low settling velocity. The proximate mechanisms causing the positively skewed distribution were investigated. The distribution could not be attributed to the distribution pattern of ovule number per ovary, pollen grain limitation, lack of ovule fertilization, or post-fertilization elimination of many-seeded pods. Rather, it was caused by the post-fertilization abortion of seeds within a pod 2 weeks after fertilization. This intra-pod seed abortion (IPSA) is due to a dominance hierarchy of fertilized ovules from the distal (near stigma) to the basal end, generated by the temporal differences in fertilization. The dominant developing seeds at the distal end cause the abortion of others through the production and diffusion of an aborting agent. When the dominance hierarchy of the siblings is not intense, pods are formed with more than one seed. We argue that the positively skewed distribution of seeds per pod is not due to maternal regulation but is a result of sibling rivalry. We propose that this sibling rivalry is generated by genetic differences in pollen grain fitness and disucss the results in the context of parent-offspring conflict.

Seed size optimization in a wind dispersed tree Butea monosperma: a trade-off between seedling establishment and pod dispersal efficiency.

Seed size optimization theories are generally based on the assumption that seedling fitness increases at a decreasing rate with seed size. But often, offspring fitness is also influenced by other components such as dispersal efficiency, especially in wind, water and animal dispersed species. We argue that in these species where the dispersal efficiency of the seeds and fruits decreases with the seed mass, the latter is optimised in order to maximize the product of the two components of offspring fitness namely, seedling establishment and dispersal efficiency. In this paper, we show that seed mass in a wind dispersed tree, Butea monosperma is a consequence of selection in opposite directions to favour seedling establishment on one hand and wing loading (dispersal efficiency of pods) on the other hand. We also discuss the interaction of various components of the pod in optimising the seed size.

Does long‐distance pollen dispersal preclude inbreeding in tropical trees? Fragmentation genetics of Dysoxylum malabaricum in an agro‐forest landscape

Tropical trees often display long‐distance pollen dispersal, even in highly fragmented landscapes. Understanding how patterns of spatial isolation influence pollen dispersal and interact with background patterns of fine‐scale spatial genetic structure (FSGS) is critical for evaluating the genetic consequences of habitat fragmentation. In the endangered tropical timber tree Dysoxylum malabaricum (Meliaceae), we apply eleven microsatellite markers with paternity and parentage analysis to directly estimate historic gene flow and contemporary pollen dispersal across a large area (216 km2) in a highly fragmented agro‐forest landscape. A comparison of genetic diversity and genetic structure in adult and juvenile life stages indicates an increase in differentiation and FSGS over time. Paternity analysis and parentage analysis demonstrate high genetic connectivity across the landscape by pollen dispersal. A comparison between mother trees in forest patches with low and high densities of adult trees shows that the frequency of short‐distance mating increases, as does average kinship among mates in low‐density stands. This indicates that there are potentially negative genetic consequences of low population density associated with forest fragmentation. Single isolated trees, in contrast, frequently receive heterogeneous pollen from distances exceeding 5 km. We discuss the processes leading to the observed patterns of pollen dispersal and the implications of this for conservation management of D. malabaricum and tropical trees more generally.

Fruit preference criteria by Avian Frugivores: their implications for the evolution of clutch size in Solanum pubescens

Solanum pubescens is dispersed by red-vented bulbuls, which forage on its fruits and defecate the seeds. We tested three alternative fruit-preference criteria proposed to be used by the avian frugivores, namely that based on the absolute pulp content, pulp-to-seed weight ratio, and the benefit-to-cost ratio of handling the fruits, each with entirely different consequences on the evolution of clutch size in plants. Both in the field and laboratory, red-vented bulbuls were found to base their preference on the benefit-to-cost ratio of harvesting the fruits and not on the other two criteria. This preference criterion also appears to have shaped the clutch size in Solanum; seed number per fruit was normally distributed around the mode corresponding to the fruit sizes preferred by birds. Based on our results we argue that avian frugivores prefer fruits that yield the highest benefit-to-cost ratio of harvesting them and discuss its implications for the evolution of clutch size in bird-dispersed species.

Extraction of non-timber forest products in the Forests of Biligiri Rangan Hills, India. 3. Productivity, extraction and prospects of sustainable harvest of amla phyllanthus emblica, (Euphorbiaceae)

Sustainable extraction of non-timber forest products (NTFPs) depends upon harvesting a small fraction of the total productivity. Over-exploitation can lead to a loss of biodiversity, but a low level of extraction, without value addition at the point of origin, is usually not economically feasible for extractors. Extraction and productivity levels per unit area for most non-timber forest products are unknown, nor do we have much information about value addition at various points in the marketing channels. Here we determine extraction and productivity levels for Amla trees (Phyllanthus emblica), which yield fruits that are used for a wide variety of purposes in preparation of various foods, beverages and medicines. We also present preliminary data on the price appreciation of the fruit for one of the processed products. We have determined that the current level of extraction, 60-80% of all fruits at the population level, may have a negative effect on new recruitment. We present a model for value addition that has the potential to enhance income and reduce the level of extraction. This model is currently being implemented by the Soliga community with the assistance of a non-governmental organization.RésuméA exploração sustentável dos recursos florestais não madereiros esta baseada na extração de uma pequena fração da produtividade total desses recursos. A exploração excessiva pode levar a perda da biodiversidade, e por outro lado, a exploração em pequena quantidade pode ser economicamente inviável. Níveis de extraçáo e produtividade por unidade de área são desconhecidos para grande parte desses recursos, assim como informaçóes sobre valores adicionais em vários pontos dos canais de mercado. Neste trabalho, nós determinamos niveis de extraçáo e produtividade para frutos de Amla (Phyllanthus emblica), os quais são utilizados na preparação de comidas e medicamentos. Nós apresentamos dados preliminares de apreciaçáo de preço do fruto para um dos produtos processados. Nós determinamos também que o nível de extração atual, 60-80% de todos os frutos produzidos a nível de população, pode ter um efeito negativo no recrutamento de plântulas. Nós apresentamos um modelo de valor aditivo que tem o potencial de aumentar a renda e reduzir o nível de extração. Este modelo está atualmente sendo implementado pela comunidade Soliga com a assistência de uma organização não governamental.