Janine Robert-Baudouy

Specific interaction between OutD, an Erwinia chrysanthemi outer membrane protein of the general secretory pathway, and secreted proteins

OutD is an outer membrane component of the main terminal branch of the general secretory pathway (GSP) in Erwinia chrysanthemi. We analyzed the interactions of OutD with other components of the GSP (Out proteins) and with secreted proteins (PelB, EGZ and PemA). OutD is stabilized by its interaction with another GSP component, OutS. The 62 C‐terminal amino acids of OutD are necessary for this interaction. In vivo formation of OutD multimers, up to tetramers, was proved after the dissociation in mild conditions of the OutD aggregates formed in the outer membrane. Thus, OutD could form a channel‐like structure in the outer membrane. We showed that OutD is stabilized in vivo when co‐expressed with Out‐secreted proteins. This stabilization results from the formation of complexes that were detected in experiments of co‐immunoprecipitation and co‐sedimentation in sucrose density gradients. The presence of the N‐terminal part of OutD is required for this interaction. The interaction between OutD and the secreted protein PelB was confirmed in vitro, suggesting that no other component of the GSP is required for this recognition. No interaction was observed between the E.carotovora PelC and the E.chrysanthemi OutD. Thus, the interaction between GspD and the secreted proteins present in the periplasm could be the key to the specificity of the secretion machinery and a trigger for that process.

Characterization of DsbC, a periplasmic protein of Erwinia chrysanthemi and Escherichia coli with disulfide isomerase activity

We identified and characterized an Erwinia chrysanthemi gene able to complement an Escherichia coli dsbA mutation that prevents disulfide bond formation in periplasmic proteins. This gene, dsbC, codes for a 24 kDa periplasmic protein that contains a characteristic active site sequence of disulfide isomerases, Phe‐X‐X‐X‐X‐Cys‐X‐X‐Cys. Besides the active site, DsbC has no homology with DsbA, thioredoxin or eukaryotic protein disulfide isomerase and it could define a new subfamily of disulfide isomerases. Purified DsbC protein is able to catalyse insulin oxidation in a dithiothreitol dependent manner. The E.coli gene xprA codes for a protein functionally equivalent to DsbC. The in vivo function of DsbC seems to be the formation of disulfide bonds in proteins. The presence of XprA could explain the residual disulfide isomerase activity existing in dsbA mutants. Re‐oxidation of XprA does not seem to occur through DsbB, the protein that probably re‐oxidizes DsbA.

pecS: a locus controlling pectinase, cellulase and blue pigment production in Erwinia chrysanthemi

Erwinia chrysanthemi mutants (designated as pecS) displaying derepressed pectate lyase and cellulose synthesis were isolated. In addition, the pecS mutation is responsible for production of an extracellular insoluble blue pigment whose synthesis is cryptic in the wild‐type 3937 strain. Transduction analysis indicates that the phenotype is due to a single mutation located near the xyl marker on the strain 3937 chromosome. This mutation was complemented by an R‐prime plasmid carrying the xyl and argG genes of E. chrysanthemi, suggesting that the pecS product acts in trans to modulate pectinase, cellulase and blue pigment production. Insertion mutagenesis of the cloned region and recombination of the corresponding mutations in the bacterial chromosome by marker exchange revealed the existence of two divergently transcribed genes, pecS and pecM, that are both involved in the pectate lyase and cellulase regulation. The nucleotide sequences of pecS and pecM were determined. The pecS gene encodes a 166 amino acid polypeptide that shows similarity to the MprA regulatory protein of Escherichia coli whereas the pecM gene encodes a 297 amino acid polypeptide that was shown to be an integral membrane protein. The possible functions of the PecS and PecM proteins derived from the mutant phenotype and sequence analysis are discussed in terms of signal transduction and transcription regulation.

Characterization of kdgR, a gene of Erwinia chrysanthemi that regulates pectin degradation

Erwinia chrysanthemi is a phytopathogenic enterobacterium able to degrade the pectic fraction of plant cell walls. The kdgR negative regulatory gene controls all the genes involved in pectin catabolism, including the pel genes encoding pectate lyases. The E. chrysanthemi kdgR regulatory gene was subcloned in Escherichia coli where it was shown to be functional, since it repressed the expression of a pelE::uidA fusion. The nucleotide sequence of kdgR contained an open reading frame of 918bp preceded by classical transcriptional initiation signals. KdgR shows similarity to two other regulatory proteins, namely GylR, encoding an activator protein of the glycerol operon in Streptomyces coelicolor, and IclR, encoding a repressor of the acetate operon in Salmonella typhimurium and in Escherichia coli. Previously, comparison of regulatory regions of several genes controlled by kdgR revealed the existence of a conserved region which was proposed as a KdgR‐binding site. The 25 bp oligonucleotide AAAAAAGAAACATTG‐TTTCATTTGT corresponding to this consensus was substituted to the lac operator, at the beginning of transcription of the lacZ gene. This construct functioned as an operator for binding of the KdgR protein in vivo.

Characterization of the pelL gene encoding a novel pectate lyase of Erwinia chrysanthemi 3937

Erwinia chrysanthemi 3937 secretes five major isoenzymes of pectate lyases encoded by the pelA, pelB, pelC, pelD and pelE genes. Recently, a new set of pectate lyases was identified in E. chrysanthemi mutants deleted of those pel genes. We cloned the pelL gene, encoding one of these secondary pectate lyases of E. chrysanthemi 3937, from a genomic bank of a strain deleted of the five major pel genes. The nucleotide sequence of the region containing the pelL gene was determined. The pelL reading frame is 1275 bases long, corresponding to a protein of 425 amino acids including a typical amino‐terminal signal sequence of 25 amino acids. Comparison of the amino acid sequences of PelL and the exo‐pectate lyase PelX of E. chrysanthemi EC16 revealed a low homology, limited to 220 residues of the central part of the proteins. No homology was detected with other bacterial pectinolytic enzymes. Regulation of pelL transcription was analysed using gene fusion. As shown for the other pel genes, the transcription of pelL is dependent on various environmental conditions. It is induced by pectic catabolic products and affected by growth phase, temperature, iron starvation, osmolarity, anaerobiosis, nitrogen starvation and catabolite repression. Regulation of pelL expression appeared to be independent of the KdgR repressor, which controls all the steps of pectin catabolism. In contrast, the pecS gene, which is involved in regulation of the synthesis of the major pectate lyases and of cellulase, also appeared to be involved in pelL expression. The PelL protein is able to macerate plant tissue. This enzyme has a basic isoelectric point, presents an endo‐cleaving activity on polygalacturonate or partially methylated pectin, with a basic pH optimum and an absolute requirement for Ca2+. The pelL mutant displayed a reduced virulence on potato tubers and Saintpaulia ionantha plants, demonstrating the important role of this enzyme in soft‐rot disease.

Some of the out genes involved in the secretion of pectate lyases in Erwinia chrysanthemi are regulated by kdgR

The out genes of Erwinia chrysanthemi are required for the translocation across the outer membrane of pectate lyases and cellulases. We present the characterization and the nucleotide sequence of five genes of the out cluster. The products of outS, B, C, D and E have significant homology with the Puts, B, C, D and E proteins necessary to the secretion of pullulanase in Klebsiella pneumoniae. An open reading frame, outT, located between outB and outC has no homology with the pul cluster but is involved in secretion. cute, outD and outE form an operon while outS, outB and outT constitute independent transcription units. outT and the outCDE operon are regulated by kdgR, the negative regulatory gene controlling pectinase production. outB and outS seem to be expressed constitutively.

Osmoregulated periplasmic glucan synthesis is required for Erwinia chrysanthemi pathogenicity.

Erwinia chrysanthemi is a phytopathogenic enterobacterium causing soft rot disease in a wide range of plants. Osmoregulated periplasmic glucans (OPGs) are intrinsic components of the gram-negative bacterial envelope. We cloned the opgGH operon of E. chrysanthemi, encoding proteins involved in the glucose backbone synthesis of OPGs, by complementation of the homologous locus mdoGH of Escherichia coli. OpgG and OpgH show a high level of similarity with MdoG and MdoH, respectively, and mutations in the opgG or opgH gene abolish OPG synthesis. The opg mutants exhibit a pleiotropic phenotype, including overproduction of exopolysaccharides, reduced motility, bile salt hypersensitivity, reduced protease, cellulase, and pectate lyase production, and complete loss of virulence. Coinoculation experiments support the conclusion that OPGs present in the periplasmic space of the bacteria are necessary for growth in the plant host.

Characterization of pectin methylesterase B, an outer membrane lipoprotein of Erwinia chrysanthemi 3937

The secretion of extracellular pectinases, among which there are least six isoenzymes of pectate lyase and one pectin methylesterase, allows the phytopathogenic bacterium Erwinia chrysanthemi to degrade pectin. A gene coding for a novel pectin methylesterase has been cloned from an E. chrysanthemi strain 3937 gene library. This gene, pemB, codes for a 433‐amino‐acid protein. The PemB N‐terminal region has the characteristics of lipoprotein signal sequences. We have shown that the PemB precursor is processed and that palmitate is incorporated into the mature protein. The PemB lipoprotein is not released into the extracellular medium and is localized in the outer membrane. The PemB sequence presents homology with other pectin methylesterases from bacterial and plant origin. pemB‐like proteins were detected in four other E. chrysanthemi strains but not in Erwinia carotovora strains. PemB was overproduced in Escherichia coli and purified to homogeneity. PemB activity is strongly increased by non‐ionic detergents. The enzyme is more active on methylated oligogalacturonides than on pectin, and it is necessary for the growth of the bacteria on oligomeric substrates. PemB is more probably involved in the degradation of methylated oligogalacturonides present in the periplasm of the bacteria, rather than in a direct action on extracellular pectin. pemB expression is inducible in the presence of pectin and is controlled by the negative regulator KdgR.

Purification and functional characterization of the KdgR protein, a major repressor of pectinolysis genes of Erwinia chrysanthemi

The phytopathogenicity of the enterobacterium Erwinia chrysanthemi chiefly results from its capacity to degrade pectin, which is the major component of plant cell walls. This degradation requires the product of 12 genes which constitute independent transcriptional units. All these genes, including kdgT which encodes the 2‐keto‐3‐deoxygluconate (KDG) transport system, are negatively regulated by the KdgR protein. The E. chrysanthemi KdgR gene was cloned into an expression vector and overexpressed in Escherichia coli. KdgR was then purified to homogeneity by two chromatographic steps as a dimer of approximately 62kDa. Using gel retardation assays, we demonstrated that this purified repressor binds to the 25 bp oligonucleotide (AAAAAAGAAACATTGTTTCATTTGT) present in the kdgT regulatory region. Dimethyl sulphate interference experiments revealed that the repressor interacts with four guanine bases and 10 adenine bases in the two strands of this KdgR box. KDG, an actual inducer of pectinolysis, releases the repressor from the operator complexes, whereas galacturonate, which is the precursor of the actual inducer, does not. These results suggest the existence of a specific interaction between KDG and KdgR protein. This study opens discussion on the relative affinity of the KdgR protein for the different operators of pectinolysis genes which are interpreted in terms of differential regulation.

Purification and functional characterization of PecS, a regulator of virulence‐factor synthesis in Erwinia chrysanthemi

The Erwinia chrysanthemi pecS gene encodes a repressor that negatively regulates the expression of virulence factors such as pectinases or cellulases. The cloned pecS gene was overexpressed using a phage T7 system. The purification of PecS involved DEAE‐anion exchange and TSK‐heparin columns and delivered the PecS protein that was purified to homogeneity. The purified repressor displayed an 18 kDa apparent molecular mass and an isoelectric point near to neutrality (PI = 6.5). Gel‐filtration experiments revealed that the PecS protein is a dimer. Bandshift assays demonstrated that the PecS protein could specifically bind in vitro to the regulatory sites of the in vivo PecS‐regulated genes. The interaction between the PecS protein and its DNA‐binding site was characterized by a relatively low affinity (about 10−8 M). DNase I footprintings revealed short protected sequences only with the most in vivo PecS‐regulated genes. Alignment of these PecS‐binding sites did not show a well‐conserved consensus sequence. lmmunoblotting demonstrated that the copy number of the PecS protein was approximately 50 dimers per cell. The low affinity of the PecS repressor for its DNA targets and the low cellular PecS content suggest the existence of E. chrysanthemi‐specific factors able to potentiate PecS protein activity in vivo.