Javaria Qazi

Suppressors of RNA Silencing Encoded by the Components of the Cotton Leaf Curl Begomovirus-BetaSatellite Complex

Begomoviruses (family Geminiviridae) are single-stranded DNA viruses transmitted by the whitefly Bemisia tabaci. Many economically important diseases in crops are caused by begomoviruses, particularly in tropical and subtropical environments. These include the betasatellite-associated begomoviruses causing cotton leaf curl disease (CLCuD) that causes significant losses to a mainstay of the economy of Pakistan, cotton. RNA interference (RNAi) or gene silencing is a natural defense response of plants against invading viruses. In counter-defense, viruses encode suppressors of gene silencing that allow them to effectively invade plants. Here, we have analyzed the ability of the begomovirus Cotton leaf curl Multan virus (CLCuMV) and its associated betasatellite, Cotton leaf curl Multan β-satellite (CLCuMB) which, together, cause CLCuD, and the nonessential alphasatellite (Cotton leaf curl Multan alphasatellite [CLCuMA]) for their ability to suppress gene silencing in Nicotiana benthamiana. The results showed that CLCuMV by itself was unable to efficiently block silencing. However, in the presence of the betasatellite, gene silencing was entirely suppressed. Silencing was not affected in any way when infections included CLCuMA, although the alphasatellite was, for the first time, shown to be a target of RNA silencing, inducing the production in planta of specific small interfering RNAs, the effectors of silencing. Subsequently, using a quantitative real-time polymerase chain reaction assay and Northern blot analysis, the ability of all proteins encoded by CLCuMV and CLCuMB were assessed for their ability to suppress RNAi and the relative strengths of their suppression activity were compared. The analysis showed that the V2, C2, C4, and βC1 proteins exhibited suppressor activity, with the V2 showing the strongest activity. In addition, V2, C4, and βC1 were examined for their ability to bind RNA and shown to have distinct specificities. Although each of these proteins has, for other begomoviruses or betasatellites, been previously shown to have suppressor activity, this is the first time all proteins encoded by a geminiviruses (or begomovirus-betasatellite complex) have been examined and also the first for which four separate suppressors have been identified.

Legume yellow mosaic viruses: genetically isolated begomoviruses.

SUMMARY The yellow mosaic diseases of a number of legumes across Southern Asia are caused by four species of whitefly-transmitted geminiviruses (genus Begomovirus, family Geminiviridae): Mungbean yellow mosaic virus, Mungbean yellow mosaic India virus, Dolichos yellow mosaic virus and Horsegram yellow mosaic virus. They cause losses to a number of important pulse crops, a major source of dietary protein in the region. The viruses have host ranges limited to plants of the family Fabaceae and efforts to limit losses are hampered by limited availability of conventional resistance sources and/or the lack of durability of the resistance that has been identified. There is ample evidence for genetic interaction between these begomoviruses within the legumes, in the form of both classical recombination and component exchange, but little evidence for interaction with viruses that infect other plants. This is indicative of genetic isolation, the viruses in legumes evolving independently of the begomoviruses in plant species of other families. This has implications for the development of engineered resistance in legumes, which holds the promise of durability but has yet to be transferred to the field. TAXONOMY The viruses causing yellow mosaic diseases of legumes across southern Asia, four of which have been identified so far, are bipartite begomoviruses (genus Begomovirus, family Geminiviridae): Mungbean yellow mosaic virus, Mungbean yellow mosaic India virus, Horsegram yellow mosaic virus and Dolichos yellow mosaic virus. Physical properties: The legume yellow mosaic viruses (LYMVs), like all members of the Geminiviridae, have geminate (twinned) particles, 18-20 nm in diameter, 30 nm long, apparently consisting of two incomplete T = 1 icosahedra joined together in a structure with 22 pentameric capsomers and 110 identical protein subunits. DISEASE SYMPTOMS Symptoms caused by LYMVs are largely dependent on host species and susceptibility. Initially symptoms appear as small yellow specks along the veins and then spread over the leaf. In severe infections the entire leaf may become chlorotic. In blackgram the chlorotic areas sometimes turn necrotic. Infections of French bean usually do not produce a mosaic but instead induce a downward leaf curling. DISEASE CONTROL Control is based mainly on preventing the establishment of the whitefly vector, Bemisia tabaci, in the crop by application of insecticides. Changes in agricultural practices, such as moving the cropping period out of periods of high vector incidence (the wet period in late summer) to times of low vector incidence (dry season in early summer) have met with some, albeit short-term, benefits. The use of natural, host plant resistance is efficacious, although the available sources of resistance in most legume crops are limited. In mungbean the resistance is attributed to two recessive genes which are used effectively to control the disease. USEFUL WEBSITES http://www.danforthcentre.org/iltab/geminiviridae/, http://www.iwglvv.org/

Genetic diversity and phylogeography of begomoviruses infecting legumes in Pakistan

Grain legumes are an important source of dietary protein across southern Asia, but they suffer extensive losses due to several viruses that are members of the genus Begomovirus (family Geminiviridae), which are collectively known as legume yellow mosaic viruses (LYMVs). Despite their economic importance, little attention has been paid to LYMVs in Pakistan and only partial sequences of virus isolates originating from this country are available in the databases. Here, a survey of LYMVs occurring across Pakistan is described. Complete sequences of 44 components (23 DNA-A, 19 DNA-B and 2 betasatellites) were determined. The results show that only the mungbean yellow mosaic India virus (MYMIV) is of agricultural significance in Pakistan having been isolated from all cultivated grain legumes examined. Mungbean yellow mosaic virus, a significant crop pathogen in India, was only identified in a weed, which together with a novel species of LYMV we reported earlier, represents the first LYMV identified in non-cultivated plants. MYMIV was shown to occur as two types in Pakistan that show phylogeographical segregation. Additionally, two begomovirus species not considered pathogens of legumes and a betasatellite were isolated. This is of grave concern since it suggests that the presumed genetic isolation of the LYMVs in legumes may be being breached. LYMVs show little, if any, evidence of interspecific recombination with non-legume infecting begomoviruses. Thus, either recombination with non-legume viruses or interaction with betasatellites, which are host range and pathogenicity determining satellites of begomoviruses, could lead to the appearance of more aggressive virus variants/strains affecting legumes.

Molecular characterisation and infectivity of a “Legumovirus” (genus Begomovirus: family Geminiviridae) infecting the leguminous weed Rhynchosia minima in Pakistan

The legume yellow mosaic viruses (LYMVs) that cause extensive losses to grain legumes across southern Asia are an evolutionarily unusual group of begomoviruses (genus Begomovirus; family Geminiviridae) with bipartite genomes. All previously identified LYMVs were isolated from leguminous crop species. Here we have identified a virus related to the LYMVs in a common weed, the legume Rhynchosia minima originating from Pakistan. Analysis of the sequence of the virus shows it to be a typical bipartite begomovirus. Sequence comparisons to all other begomovirus sequences available in the databases show the virus from R. minima to be distinct, with the highest level of sequence identity (69.5%) to an isolate of Mungbean yellow mosaic virus. This indicates that the virus identified here is a new species in the genus Begomovirus for which we propose the name Rhynchosia yellow mosaic virus (RhYMV). By Agrobacterium-mediated inoculation we show that, in common with the other LYMVs, the clones of RhYMV are not infectious to the experimental host Nicotiana benthamiana. In soybean, the results of inoculation depended upon the variety. In soybean var. Ig6 the symptoms were mild and plants recovered from infection. However, in var. FS-85, symptoms were severe and progressed to necrosis, indicative of a hypersensitive response. These results indicate that there is resistance to RhYMV in the soybean germplasm. The significance of these results is discussed.

Molecular characterisation of banana bunchy top virus (BBTV) from Pakistan.

Banana bunchy top disease is caused by a single-stranded circular DNA virus, banana bunchy top virus (BBTV), which is a member of the genus Babuvirus (family Nanoviridae). We have cloned and sequenced five components (DNA-R, DNA-S, DNA-N, DNA-M and DNA-C) of a BBTV isolate originating from Pakistan. In addition, the DNA-R and several other components of five further isolates, originating from geographically distinct sites across the banana-growing area of Sindh province, Pakistan, were cloned and sequenced. Analysis of the sequences indicates that BBTV present in Pakistan belongs to the “South Pacific” group of isolates and that the genetic diversity of the virus in the country is very low. The virus shows the highest levels of sequence identity to BBTV isolates originating from Egypt, India and Australia. The significance of these results with respect to the possible origin of the virus in Pakistan and the prospects for obtaining genetically engineered resistance to the virus are discussed.

A PCR-based method, with internal control, for the detection of Banana bunchy top virus in banana

Banana bunchy top disease is a major constraint to banana production in most regions where this crop is grown. The disease is caused by Banana bunchy top virus (BBTV), a multicomponent, single-stranded DNA virus of the family Nanoviridae. We have designed primers to a conserved region of the master replication-associated protein that are useful for the polymerase chain reaction (PCR)-mediated detection of BBTV. In addition, primers to banana genomic sequence are used as an internal control, overcoming the uncertainty (owing to false-negatives) inherent in PCR diagnostics. Together these primer sets are a valuable tool in the effort to control BBTV, particularly in screening micropropagated banana plantlets for the absence of virus before release to farmers.

Hurdles to the global antipolio campaign in Pakistan: an outline of the current status and future prospects to achieve a polio free world

The Global Polio Eradication Initiative to eradicate polio completely by the year 2000 has been successful, except for three endemic and some non-endemic countries. Pakistan, one of the three endemic polio reservoirs, is posing a serious threat to the success of the initiative. Currently, the expanded programme on immunisation has been geared to win the race over polio virus in Pakistan. After the remarkable decrease in polio cases from 198 in 2011 to only 58 in 2012, Pakistan seemed to be at the verge of success. However, hurdles continue to retard the campaign. The war against terrorism, misconceptions about polio vaccine, religious misinterpretations, frustration among vaccinators, lack of awareness, social considerations, natural calamities, inaccessibility, and inefficient vaccines and so on are continually rupturing the foundations of the worldwide initiative in the country. Weak health management is found at the hub of majority of the challenges. Stricter policies, well managed and supervised plans and strategic actions, risk analysis and enhanced communication may help giving the final punch to polio virus in the country. Analysis suggested that there is some literature available on the challenges to polio elimination, yet there is not a single publication up to date that considers all the possible hurdles in a single manuscript. This paper sorts out the breaches that hamper the goal of eliminating polio from Pakistan. We have evaluated all the possible barriers and explained them with a perspective that will help develop area specific strategies against polio virus and thus eradicate polio virus from the world.

Measles outbreaks in pakistan: causes of the tragedy and future implications

Abstract Measles outbreaks have been reported in various parts of the world; however, they have not claimed as many lives as in Pakistan (2012-2013). These outbreaks started in December 2012 in Sindh Province and spread afterwards to

A Severe Leaf Curl Disease on Chilies in Pakistan is Associated with Multiple Begomovirus Components

Chili leaf curl disease is an important limiting factor for chilies in the Indian subcontinent and is associated with begomoviruses (2,3). Field visits of commercially grown chilies in 2007 and 2008 identified a very severe leaf curl disease with 100% incidence and severe yield losses at several locations in Faisalabad District, Punjab, Pakistan. Symptoms of the disease were severe leaf curl with cup-shaped, upward curling, yellowing, and stunted plant growth. To identify the causative agent, symptomatic plant samples were collected from 10 locations and total DNA was extracted with a cetyltrimethylammoniumbromide method. Universal primers that amplify begomovirus DNA A, Begomo F (ACGCGT GCCGTGCTGCTGCCCCCATTGTCC) and Begomo R (ACGCGT ATGGGCTGYCGAAGTTSAGAC), were used in PCR. A PCR product of the expected size (approximately 2.8 kb) was amplified from all symptomatic plants, and no amplification products of the expected size were obtained from healthy or asymptomatic plants, confirming the association of a begomovirus with the disease. When used as a probe in Southern hybridization, a full-length clone of Cotton leaf curl Multan virus detected characteristic viral DNA forms and further confirmed the association of begomovirus with the disease. To identify the begomovirus associated with the disease at the species level, the PCR product obtained with universal primers was cloned into a TA cloning vector and five clones were partially sequenced. Comparison of the DNA sequence of the coat protein gene of clones resulted in identification of two begomovirus species; the first clone (GenBank Accession No. FN179278) showed 94% DNA sequence identity with the bipartite virus Tomato leaf curl New Delhi virus (ToLCNDV), while the second clone (GenBank Accession No. FN252382) showed 97% sequence identity with the monopartite begomovirus Chili leaf curl Multan virus (ChLCMV). Rolling circle amplification was used to clone the DNA B of ToLCNDV from samples showing typical chili leaf curl disease symptoms. Sequence analysis of the DNA B clone (GenBank Accession No. FN179276) in the intergenic region and movement protein gene showed 94% identity with ToLCNDV DNA B. To confirm association of betasatellite with the disease, universal primers (β-01 and β-02) were used for the amplification of betasatellite by PCR (1). DNA sequence analysis of betasatellite (GenBank Accession No. FN179279) associated with the disease showed 90% identity with the previously cloned chili leaf curl betasatellite (1). No evidence for the association of alphasatellite with the disease was found. The multiple infection of a begomovirus complex, consisting of a monopartite virus with a bipartite begomovirus where DNA B is maintained in the presence of betasatellite, presents yet another example of rapid changes in begomovirus complexes that infect important crops in the region. The appearance of chili leaf curl disease at a higher incidence and symptom severity may be attributed to the synergistic action of geminivirus disease complex comprising a monopartite and a bipartite begomovirus along with DNA betasatellite. High yield losses resulting from this severe disease threatens chili cultivation in the area and is forcing farmers to grow other crops. References: (1) R. W. Briddon et al. Virology 312:106, 2003. (2) B. Chattopadhyay et al. Arch Virol. 10:7, 2007. (3) M. Hussain et al. Plant Pathol. 53:794, 2004.

Identification of a major pathogenicity determinant and suppressors of RNA silencing encoded by a South Pacific isolate of Banana bunchy top virus originating from Pakistan

Five genes encoded by Banana bunchy top virus (BBTV) originating from Pakistan were expressed in Nicotiana benthamiana using a Potato virus X (PVX) vector. Expression of the master replication-associated protein (mRep) and movement protein (MP) resulted in necrotic cell death of inoculated tissues, as well as leaf curling and necrosis along the veins in newly emerging leaves. The systemic necrosis induced by the expression of MP was discolored (dark) in comparison to that induced by mRep. Expression of the cell-cycle link protein (Clink), the coat protein (CP), and the nuclear shuttle protein from the PVX vector induced somewhat milder symptoms, consisting of mild leaf curling and mosaic, although expression of the CP caused a necrotic response in inoculated leaf. The accumulation of viral RNA was enhanced by MP, Clink, and CP. Of the five BBTV-encoded gene products two, the MP and Clink, stabilized GFP-specific mRNA and reduced GFP-specific small interfering RNA in N. benthamiana line 16c when expressed under the control of the 35S promoter and co-inoculated with a construct for the expression of GFP hairpin RNA construct. These results identified MP and Clink as suppressors of RNA silencing. Taken together the ability of MP to induce severe symptoms in plants and suppress RNA silencing implicates this product as a major pathogenicity determinant of BBTV.