Kathryn N. North

Mutations in ACTN4, encoding α-actinin-4, cause familial focal segmental glomerulosclerosis

Focal and segmental glomerulosclerosis (FSGS) is a common, non-specific renal lesion. Although it is often secondary to other disorders, including HIV infection, obesity, hypertension and diabetes, FSGS also appears as an isolated, idiopathic condition. FSGS is characterized by increased urinary protein excretion and decreasing kidney function. Often, renal insufficiency in affected patients progresses to end-stage renal failure, a highly morbid state requiring either dialysis therapy or kidney transplantation. Here we present evidence implicating mutations in the gene encoding α-actinin-4 (ACTN4; ref. 2), an actin-filament crosslinking protein, as the cause of disease in three families with an autosomal dominant form of FSGS. In vitro, mutant α-actinin-4 binds filamentous actin (F-actin) more strongly than does wild-type α-actinin-4. Regulation of the actin cytoskeleton of glomerular podocytes may be altered in this group of patients. Our results have implications for understanding the role of the cytoskeleton in the pathophysiology of kidney disease and may lead to a better understanding of the genetic basis of susceptibility to kidney damage.

Distinctive patterns of microRNA expression in primary muscular disorders

The primary muscle disorders are a diverse group of diseases caused by various defective structural proteins, abnormal signaling molecules, enzymes and proteins involved in posttranslational modifications, and other mechanisms. Although there is increasing clarification of the primary aberrant cellular processes responsible for these conditions, the decisive factors involved in the secondary pathogenic cascades are still mainly obscure. Given the emerging roles of microRNAs (miRNAs) in modulation of cellular phenotypes, we searched for miRNAs regulated during the degenerative process of muscle to gain insight into the specific regulation of genes that are disrupted in pathological muscle conditions. We describe 185 miRNAs that are up- or down-regulated in 10 major muscular disorders in humans [Duchenne muscular dystrophy (DMD), Becker muscular dystrophy, facioscapulohumeral muscular dystrophy, limb-girdle muscular dystrophies types 2A and 2B, Miyoshi myopathy, nemaline myopathy, polymyositis, dermatomyositis, and inclusion body myositis]. Although five miRNAs were found to be consistently regulated in almost all samples analyzed, pointing to possible involvement of a common regulatory mechanism, others were dysregulated only in one disease and not at all in the other disorders. Functional correlation between the predicted targets of these miRNAs and mRNA expression demonstrated tight posttranscriptional regulation at the mRNA level in DMD and Miyoshi myopathy. Together with direct mRNA–miRNA predicted interactions demonstrated in DMD, some of which are involved in known secondary response functions and others that are involved in muscle regeneration, these findings suggest an important role of miRNAs in specific physiological pathways underlying the disease pathology.

The nature and frequency of cognitive deficits in children with neurofibromatosis type 1

Objective: To assess the frequency and severity of specific cognitive deficits in children with neurofibromatosis type 1 (NF1) in a large unbiased cohort. Methods: Extensive cognitive assessments were performed in 81 children with NF1 ages 8 to 16 years and their performance was compared with that of 49 unaffected sibling controls. Results: Eighty-one percent of the children with NF1 had moderate to severe impairment in one or more areas of cognitive functioning. Although 51% of children with NF1 performed poorly on tasks of reading, spelling, and mathematics, specific learning disabilities (as defined by IQ–achievement discrepancies) were present in only 20% of the children. Sustained attention difficulties were present in 63% of children with NF1, with 38% of children with NF1 fulfilling the diagnostic criteria for attention deficit–hyperactivity disorder. The NF1 neuropsychological profile is characterized by deficits in perceptual skills (visuospatial and visuoperceptual), executive functioning (planning and abstract concept formation), and attention (sustained and switching). Interestingly, both verbal and visual memory was unaffected in NF1 children, and their memory skills were in general stronger than their level of general intellectual function. Although both expressive and receptive language skills were significantly impaired in NF1 children, they appeared to be relatively better preserved than visuospatial abilities once IQ is taken into account. Conclusion: There is an extremely high frequency of cognitive problems in children with neurofibromatosis type 1, making cognitive dysfunction the most common complication to affect quality of life in these children.

A common nonsense mutation results in alpha-actinin-3 deficiency in the general population.

T he α-actinins are actin-binding proteins encoded by a multigene family. In skeletal muscle, they are a major structural component of the Z-lines that anchor the actin-containing thin filaments and maintain the spatial relationship between myofilaments 1. In humans, two genes (ACTN2 and ACTN3) encode the closely related α-actinin-2 and α-actinin-3 skeletal muscle iso-forms 2. ACTN2 is expressed in all skeletal muscle fibres, whereas expression of ACTN3 is limited to a subset of type 2 (fast) fibres 3. We have previously demonstrated absence of α-actinin-3 in muscle biopsies from several patients with muscular dystrophy 3. A follow-up study identified additional α-actinin-3−negative biopsies from neuromuscular patients with other known diseases, suggesting that this deficiency was not the primary cause of muscle weakness 4. Subsequently, we screened muscle specimens with dys-trophic (118 specimens), myopathic (74), neurogenic (20) and normal (55) features (Fig. 1a−d). Although these biopsies contained normal α-actinin-2 expression, deficiency of α-actinin-3 was identified by immunocytochemistry and western blot in 51 of 267 cases (19%), a finding not associated with any particular histo-pathological or clinical phenotype. To ascertain whether α-actinin-3 deficiency was associated with mutations of ACTN3, we used an RT-PCR approach to amplify mRNA isolated from diagnostic muscle biopsies. Using primer pairs AB16/AB9 (5´–GATGGTTATGCAGCCCGAGG–3ánd 5´–AGCAACGCCCGCACCTCCT–3´) and AB8/AB1 (5´–TGCACGAAGCCTG-GACCC–3ánd 5´–AGAGAGGGATCTT-TATTCAG–3´), we PCR-amplified two overlapping fragments encompassing bases 24−2,852 of ACTN3 mRNA (ref. 2). Initially, we focused on one family with two affected male siblings with congenital muscular dystrophy and complete deficiency of α-actinin-3. Sequencing of ACTN3 cDNA from the proband identified two changes relative to controls and the previously determined sequence M86407. These were an A→G transition at nt 1,586 in exon 15, changing a gluta-mine (CAG) to an arginine (CGG) at residue 523 (Q523R), and a C→T trans-version at position 1,747 in exon 16, converting an arginine to a stop codon at residue 577 (R577X; Fig. 1e−g). Direct sequencing of genomic DNA from the proband and the affected sibling confirmed homozygosity for both point mutations. Subsequent testing of the parents and two unaffected siblings revealed that these phenotypically normal individuals had the same genotype as the proband and were thus homozygous for the ACTN3 577X nonsense mutation. The R577X change creates a novel DdeI site (Fig. 1h). An additional 125 biopsies for which matched DNA samples were available were tested for α-actinin-3 expression and ACTN3 genotype (48 α-actinin-3−deficient and 77 α-actinin-3− positive biopsies with a mixture of histological and clinical …

Cognitive function and academic performance in neurofibromatosis. 1: consensus statement from the NF1 Cognitive Disorders Task Force.

Neurofibromatosis type 1 (NF1) is the most common single gene disorder to affect the human nervous system; it is inherited in an autosomal dominant manner with an estimated incidence of 1 in 3,500.l The physical features of NF1 are well characterized and include multiple cafe-au-lait spots, skinfold freckling, iris hamartomas (Lisch nodules), and benign and malignant neural tumors (e.g., neurofibromas, pheochromocytomas, and neurofibrosarcomas).’X2 CNS lesions include optic pathway gliomas, dural ectasia, and aqueduct stenosis. In addition to these specific pathologic lesions, cognitive impairment is common. Learning disabilities occur in at least 30 to 45% of children with NF1 and can be responsible for significant lifetime m~rb id i ty .~ ,~ The NF1 gene on human chromosome 17 has been ~ l o n e d ~ ~ and its protein product neurofibromin identified.*b9 The NF1 gene is usually classified as a tumor suppressor gene, as mutations in both NF1 alleles are detectable in malignant tumors associated with NF1lOJ1 and in benign tumors such as neurofibromas.12 The effects of the disorder on higher cortical function and the relationship between NF1 gene mutations, cognitive deficits, and intracranial pathology are less well understood. This consensus statement summarizes our current understanding of the frequency and nature of cognitive deficits and learning disability in children with NF1, provides recommendations for assessment and management, and examines the putative relationship between cognitive deficits and MRI signal abnormalities. We review possible pathogenetic mechanisms and future directions for research.

An Actn3 knockout mouse provides mechanistic insights into the association between α-actinin-3 deficiency and human athletic performance

A common nonsense polymorphism (R577X) in the ACTN3 gene results in complete deficiency of the fast skeletal muscle fiber protein alpha-actinin-3 in an estimated one billion humans worldwide. The XX null genotype is under-represented in elite sprint athletes, associated with reduced muscle strength and sprint performance in non-athletes, and is over-represented in endurance athletes, suggesting that alpha-actinin-3 deficiency increases muscle endurance at the cost of power generation. Here we report that muscle from Actn3 knockout mice displays reduced force generation, consistent with results from human association studies. Detailed analysis of knockout mouse muscle reveals reduced fast fiber diameter, increased activity of multiple enzymes in the aerobic metabolic pathway, altered contractile properties, and enhanced recovery from fatigue, suggesting a shift in the properties of fast fibers towards those characteristic of slow fibers. These findings provide the first mechanistic explanation for the reported associations between R577X and human athletic performance and muscle function.

Loss of ACTN3 gene function alters mouse muscle metabolism and shows evidence of positive selection in humans

More than a billion humans worldwide are predicted to be completely deficient in the fast skeletal muscle fiber protein α-actinin-3 owing to homozygosity for a premature stop codon polymorphism, R577X, in the ACTN3 gene. The R577X polymorphism is associated with elite athlete status and human muscle performance, suggesting that α-actinin-3 deficiency influences the function of fast muscle fibers. Here we show that loss of α-actinin-3 expression in a knockout mouse model results in a shift in muscle metabolism toward the more efficient aerobic pathway and an increase in intrinsic endurance performance. In addition, we demonstrate that the genomic region surrounding the 577X null allele shows low levels of genetic variation and recombination in individuals of European and East Asian descent, consistent with strong, recent positive selection. We propose that the 577X allele has been positively selected in some human populations owing to its effect on skeletal muscle metabolism.

Mutations in SIL1 cause Marinesco-Sjogren syndrome, a cerebellar ataxia with cataract and myopathy

SIL1 (also called BAP) acts as a nucleotide exchange factor for the Hsp70 chaperone BiP (also called GRP78), which is a key regulator of the main functions of the endoplasmic reticulum. We found nine distinct mutations that would disrupt the SIL1 protein in individuals with Marinesco-Sjögren syndrome, an autosomal recessive cerebellar ataxia complicated by cataracts, developmental delay and myopathy. Identification of SIL1 mutations implicates Marinesco-Sjögren syndrome as a disease of endoplasmic reticulum dysfunction and suggests a role for this organelle in multisystem disorders.

Specific learning disability in children with neurofibromatosis type 1: Significance of MRI abnormalities

To determine whether previously reported areas of increased T2 signal intensity on MRI examination in children with neurofibromatosis type 1 (NF 1) are associated with deficits in development and learning common in this population, we evaluated 51 children with NF 1 (aged 8 to 16 years). Forty children completed the full assessment protocol (MRI, medical, psychometric, speech therapy, and occupational therapy assessments). The mean Full Scale IQ scores for the entire study population showed a left shift compared with the normal population, and the distribution of IQ scores was bimodal, suggesting that there are two populations of patients with NF 1–those with and those without a variable degree of cognitive impairment. There was no association between lower IQ scores and any clinical variable. Areas of increased T2 signal intensity unidentified bright objects (UBO+) were present in 62.5% of the study population, and their presence was not related to clinical severity, sex, age, socioeconomic status, macrocephaly, or family history of NF 1. However, compared with children without areas of increased T2 signal intensity (UBO-), the UBO+ group had significantly lower mean values for IQ and language scores and significantly impaired visuomotor integration and coordination. Children with areas of increased T2 signal intensity were at a much higher risk for impaired academic achievement. Children without increased T2 signal on MRI (UBO-) did not significantly differ from the general population in any measure of ability or performance. Areas of increased T2 signal on MRI represent dysplastic glial proliferation and aberrant myelination in the developing brain and are associated with deficits in higher cognitive function. The presence of these abnormal signals on MRI divides the NF 1 population into two distinct groups anatomically and developmentally (UBO+ and UBO-). These two groups should be considered separately in the assessment and management of learning disability in children with NF 1.

Nemaline myopathy: A clinical study of 143 cases

We report 143 Australian and North American cases of primary nemaline myopathy. As classified by the European Neuromuscular Centre guidelines, 23 patients had severe congenital, 29 intermediate congenital, 66 typical congenital, 19 childhood‐onset, and 6 adult‐onset nemaline myopathy. Inheritance was autosomal recessive in 29 patients, autosomal dominant in 41, sporadic in 72, and indeterminate in 1. Twenty‐two patients had skeletal muscle actin mutations and 4 had mutations in the α‐tropomyosinSLOW gene. Obstetric complications occurred in 49 cases. Seventy‐five patients had significant respiratory disease during the first year of life, and 79 had feeding difficulties. Atypical features in a minority of cases included arthrogryposis, central nervous system involvement, and congenital fractures. Progressive distal weakness developed in a minority of patients. Thirty patients died, the majority during the first 12 months of life. All deaths were due to respiratory insufficiency, which was frequently underrecognized in older patients. Arthrogryposis, neonatal respiratory failure, and failure to achieve early motor milestones were associated with early mortality. Morbidity from respiratory tract infections and feeding difficulties frequently diminished with increasing age. Aggressive early management is warranted in most cases of congenital nemaline myopathy.