Leming Cheng

Characterization of an avian infectious bronchitis virus isolated in China from chickens with nephritis.

Summary One IBV isolate, SC021202, was isolated from the kidneys of the infected young chickens by inoculating embryonated eggs, and its morphology, physiochemical and haemagglutonating properties were detected. Virulence of the isolate SC021202 was determined with specific pathogen‐free (SPF) chicken inoculation. Nucleotide acid sequence of S1 gene of the isolate SC021202 was further sequenced and analysed. The physiochemical and morphological properties of the isolate SC021202 were in accordance to that of typical infectious bronchitis virus (IBV). In a pathogenicity experiment, the clinical signs and related gross lesions resembling those of field outbreak were reproduced and the virus isolate SC021202 was re‐isolated from the kidneys of the infected chicken. Sequence data demonstrated that the full length of the amplified S1 gene of the isolate SC021202 was composed of 1931 nucleotides, coding a polypeptide of 543 amino acid residues. Compared with IBV strains from GenBank, the nucleotide and deduced amino acid sequence of S1 gene of the isolate SC021202 shared 60.0–91.4% and 49.1–88.9% identities, respectively. A nucleotide fragment of ′CTTTTTAATTATACTAACGGA′ was inserted at nucleotide site 208 in the S1 gene of the isolate. These results indicated that IBV isolate SC021202 was a new variant IBV isolate and responsible for field outbreak of nephritis.

Combustion Behavior and SO2, NOx Emissions of an Anthracite Coal in a Circulating Fluidized Bed

Combustion behavior and SO2 , NOx emissions of anthracite coal in a circulating fluidized bed are reported in this paper. Experimental researches were done on a 1 MWt circulating fluidized bed facility with a 0.31 m × 0.31 m cross section and 11.2 m height combustor. The anthracite coal with 6.28% volatile and 3.76% sulfur content burns steadily during the test. The bed was operated under different temperature, Ca/S ratio and excess air. A limestone containing 75% CaCO3 and 15% MgCO3 was used as the sulfur sorbent. Results show that the SO2 emission varies with operating bed temperature and more than 90% sulfur capture efficiency can be reached while Ca/S is about 3. With Rosemount Analytical NGA2000, N2 O, NO and NO2 were also measured in the test. It was found the majority content of NOx was NO and the least was NO2 . Those NOx emissions change highly with the excess air number.Copyright

Ash deposition behavior of a high-alkali coal in circulating fluidized bed combustion at different bed temperatures and the effect of kaolin

High alkali and alkali earth metals (AAEMs) content in coal causes severe slagging and fouling during combustion in a boiler. In this study, the ash deposition behavior of a high-alkali coal at different bed temperatures and the effect of kaolin were investigated in a 30 kW circulating fluidized bed (CFB) test system using an ash slagging probe and deposition probe. The results show that the ash deposition tendency increases with the bed temperature. The condensation of Na2SO4 is an important inducement for slag formation in the furnace. The melting or partial melting of slags is attributed to Na–Fe–Ca eutectics. At 920 °C, Na2SO4 will react with CaSO4 to form the low-melting compound of Na2SO4–CaSO4. The deposited ash on the convection-heating surface consists of granular particles. On the windward side, the layered-structure ash deposits, i.e. the inner and outer layers, are formed at the bed temperature of 920 °C but are absent at lower temperatures (820 °C and 870 °C). The formation of the inner layer consists of fine particles (<2 μm) and is closely related to Na2SO4. The size of the deposited ash in the outer layer is larger than 10 μm, while that on the leeward side is less than 10 μm. By adding kaolin in the coal, the slags are replaced by loose particles due to the absorption reactions between kaolin and alkali metals. The ash deposition tendency is improved and the optimal result is achieved when kaolin is added at an addition ratio of 3%.

Effect of Riser Geometry Structure on Local Flow Pattern in a Rectangular Circulating Fluidized Bed

By using a high-speed video camera and particle image velocimetry (PIV) technique, the local flow properties of the solid-gas two phases flow were studied in a plexiglass rectangular CFB cold model with the a riser of 1.5×0.864×4.9m3. Measurements were carried out with transparent spherical glass bead between 0.1–0.425mm as bed materials and cold air as flow medium. The experimental results showed that the secondary air has an important influence on the particle velocity distribution. Because of the secondary air penetrating effect, the particle lateral movement was acute. In the dilute region, the outlet and the comer effect induced the defluxion of the particles movement and the core-annular distribution was broken. The closer to the outlet, the stronger the lateral velocity is. The obstruct of hanging screen reduced the furnace outlet effects between the hanging screen and the front wall, where the particle movement in the area was controlled by the gas flow and the constrain of the wall. High particle concentration areas were formed in the junction between the screen and the front wall and in the comer between the left wall and the front wall.