Marc A. Shuman

Phase I Study of Intraventricular Administration of Rituximab in Patients With Recurrent CNS and Intraocular Lymphoma

PURPOSE We previously determined that intravenous administration of rituximab results in limited penetration of this agent into the leptomeningeal space. Systemic rituximab does not reduce the risk of CNS relapse or dissemination in patients with large cell lymphoma. We therefore conducted a phase I dose-escalation study of intrathecal rituximab monotherapy in patients with recurrent CNS non-Hodgkins lymphoma (NHL). PATIENTS AND METHODS The protocol planned nine injections of rituximab (10 mg, 25 mg, or 50 mg dose levels) through an Ommaya reservoir over 5 weeks. The safety profile of intraventricular rituximab was defined in 10 patients. RESULTS The maximum tolerated dose was determined to be 25 mg and rapid craniospinal axis distribution was demonstrated. Cytologic responses were detected in six patients; four patients exhibited complete response. Two patients experienced improvement in intraocular NHL and one exhibited resolution of parenchymal NHL. High RNA levels of Pim-2 and FoxP1 in meningeal lymphoma cells were associated with disease refractory to rituximab monotherapy. CONCLUSION These results suggest that intrathecal rituximab (10 to 25 mg) is feasible and effective in NHL involving the CNS.

Target platelet antigen in homosexual men with immune thrombocytopenia.

A syndrome of isolated immune thrombocytopenic purpura (ITP) has recently been described in homosexual men. We have identified an antiplatelet antibody in the serum of 29 of 30 homosexual men with isolated ITP. The antibody binds to a platelet membrane antigen of 25,000 daltons, and binding is effected by the F(ab)2 portion of the immunoglobulin. Similar antibody activity was not detected in serum from 30 nonhomosexual patients with either ITP or nonimmune thrombocytopenia. The 25,000-dalton antigen was not found on other hematopoietic cells, and it was distinct from the core protein of the AIDS-associated retrovirus. In contrast, serum antibody reacted with a 25,000-dalton antigen associated with cultured herpes simplex virus Types I and II. In these experiments the antigen appeared to be derived from green-monkey kidney cells in which the herpes simplex viruses were grown. Identical antigenic activity was also demonstrated in uninfected human skin fibroblasts. We conclude that ITP in homosexual men is accompanied by a serum antibody directed against a platelet antigen of 25,000 daltons. The nature of the antigen and the relation of the serum antibody to ITP require further study.

Thrombin-Cellular Interactions

It is clear that there are a number of different types of reactions between thrombin and the cell surface (TABLE 6). In one type, thrombin binds to cell-surface receptors resulting in cellular activation. In other types of reactions, there are at least two components to the thrombin-specific pathway of cellular activation: a classical receptor to which thrombin binds, and a protein that is cleaved. In both types of reactions, thrombin binding and/or proteolysis is linked to changes in GTP-binding proteins, protein kinase C, or other pathways. In most cases, the receptor and membrane substrates involved in cellular activation are not well characterized. In another type of reaction, the interaction between thrombin and proteins in the extracellular fluid is regulated by cell-surface receptors. Binding of thrombin to these receptors can result in acceleration or inhibition of the reactions with the soluble proteins. In the fourth type of reaction, thrombin cleaves a cell-membrane protein that is involved in reactions with plasma proteins. Recognition of the different types of interactions between thrombin and the cell surface is necessary for the correct interpretation of experimental observations. Although the term receptor has classically referred to a cell-surface component to which an agonist binds, it is now clear that there are additional membrane components that specifically bind potential agonists not leading to cellular activation.

Upregulation of Cyclin B1 by miRNA and its implications in cancer

It is largely recognized that microRNAs (miRNAs) function to silence gene expression by targeting 3′UTR regions. However, miRNAs have also been implicated to positively-regulate gene expression by targeting promoter elements, a phenomenon known as RNA activation (RNAa). In the present study, we show that expression of mouse Cyclin B1 (Ccnb1) is dependent on key factors involved in miRNA biogenesis and function (i.e. Dicer, Drosha, Ago1 and Ago2). In silico analysis identifies highly-complementary sites for 21 miRNAs in the Ccnb1 promoter. Experimental validation identified three miRNAs (miR-744, miR-1186 and miR-466d-3p) that induce Ccnb1 expression in mouse cell lines. Conversely, knockdown of endogenous miR-744 led to decreased Ccnb1 levels. Chromatin immunoprecipitation (ChIP) analysis revealed that Ago1 was selectively associated with the Ccnb1 promoter and miR-744 increased enrichment of RNA polymerase II (RNAP II) and trimethylation of histone 3 at lysine 4 (H3K4me3) at the Ccnb1 transcription start site. Functionally, short-term overexpression of miR-744 and miR-1186 resulted in enhanced cell proliferation, while prolonged expression caused chromosomal instability and in vivo tumor suppression. Such phenotypes were recapitulated by overexpression of Ccnb1. Our findings reveal an endogenous system by which miRNA functions to activate Ccnb1 expression in mouse cells and manipulate in vivo tumor development/growth.

The measurement of thrombin in clotting blood by radioimmunoassay.

We have developed a radioimmunoassay for human thrombin using rabbit anti-human thrombin IgG. The assay can measure 2 ng thrombin/ml plasma, 500-fold more sensitive than clotting assays. Human prothrombin is less reactive in the assay than thrombin by at least four orders of magnitude, and there is no demonstrable cross-reactivity with human factor Xa, the clotting factor structurally most similar to thrombin. The assay does not detect thrombin bound to anthithrombin III. Using the assay, we have demonstrated that plasma from 20 normal subjects does not contain detectable thrombin. We measured thrombin generation in clotting blood in polypropylene tubes and observed that thrombin appears (approximately equal to 3 ng/ml) within 45 S-5 min after venipuncture. This material is thrombin, not intermediates of prothrombin activation, since it disappears after addition of heparin, which promotes thrombin antithrombin III complex formation. After a plateau of 2-10 min, there is further thrombin generation, which results in clotting after 15-27 min at a level of 40-50 ng thrombin/ml. The thrombin generated 9-25 min before clotting may activate factors V and VIII and stimulate platelet aggregation and release. In contrast, the cascade hypothesis assigns a role for thrombin only late in blood clotting. Radioimmunoassay of thrombin and other clotting factors will be useful for clinical and physiological studies of blood clotting especially since the assay seems specific for thrombin and is independent of other activities that affect bioassays.

NEUTRALIZING ANTI-VASCULAR ENDOTHELIAL GROWTH FACTOR ANTIBODY INHIBITS FURTHER GROWTH OF ESTABLISHED PROSTATE CANCER AND METASTASES IN A PRE-CLINICAL MODEL

PURPOSE The formation of new blood vessels from the pre-existing vasculature is necessary for support of primary tumor growth and appears coincident with the development of metastasis. In previous studies, inhibition of vascular endothelial growth factor (VEGF), a potent angiogenic factor and mediator of vascular permeability, inhibited tumor neovascularization with consequent inhibition of both primary tumor growth and micrometastases when administered at the time of tumor inoculation. In the present study, we examined the effect of inhibiting VEGF on primary tumor growth and metastases in an in vivo model of established metastatic prostate cancer. MATERIALS AND METHODS The human prostate cancer cell line DU-145 was found to secrete VEGF. DU-145.luciferase, a subclone stably transfected with an expression vector encoding the luciferase gene, injected subcutaneously, consistently formed tumors in C.B.-17 scid/scid mice. After 6 weeks, assay of whole lung lysates showed significant luciferase activity, consistent with the presence of micrometastasis. RESULTS Twice weekly treatment of the animals with a monoclonal anti-VEGF neutralizing antibody, A4.6.1, not only suppressed primary tumor growth, but inhibited metastatic dissemination to the lung. When treatment was delayed until the primary tumors were well-established, further growth was still inhibited, as was the progression of metastatic disease. CONCLUSION Inhibition of tumor-secreted VEGF by a neutralizing antibody is sufficient to significantly impair prostate tumor growth and its subsequent metastasis in an in vivo model of established advanced prostate cancer. These data suggest a critical role for VEGF in initiation and maintenance of tumor angiogenesis in prostate cancer. Inhibition of VEGF in patients with VEGF-secreting prostate cancers may prove an effective approach for inhibiting disease progression even after micro-metastatic dissemination has occurred.

Thrombopoietin Levels in Patients with Cirrhosis before and after Orthotopic Liver Transplantation

Thrombocytopenia in patients with cirrhosis has historically been attributed to hypersplenism. Radiolabeled platelet studies have clearly demonstrated splenic sequestration in cirrhosis and have shown that up to 90% of platelets can localize to the spleen [1-3]. However, portal decompression procedures have failed to consistently improve thrombocytopenia [4-7] and thrombocytopenia can persist after splenectomy [8]. Therefore, other factors must be involved. Thrombopoietin is a potent stimulator of megakaryocyte growth and platelet production [9]. Synthesis of thrombopoietin probably occurs in the liver [10]. In this study, we measured plasma thrombopoietin levels in cirrhotic patients who had thrombocytopenia and evaluated changes in these levels throughout orthotopic liver transplantation. Levels of messenger RNA (mRNA) in thrombopoietin in liver samples taken from patients with cirrhosis and controls were compared. Our hypothesis was that production of thrombopoietin is altered in patients with cirrhosis and that impaired transcription of thrombopoietin mRNA may contribute to this alteration. Methods Two separate convenience samples taken from patients with cirrhosis (17 patients who had and 27 patients who did not have orthotopic liver transplantation) were recruited from the gastroenterology services at the University of California, San Francisco, Medical Center. All 44 patients had persistent or stable thrombocytopenia for more than 2 weeks (platelet count < 120 000 cells/microL). Patients with acute intercurrent illnesses were excluded. Patients were selected for transplantation on the basis of standard criteria (severity of disease and organ availability). These patients received an ABO-matched cadaver liver and standard post-transplantation immunosuppressive drugs, including corticosteroids, azathioprine, and cyclosporine. Approval was obtained from the Committee on Human Research at the University of California, San Francisco: all patients provided informed consent. The enrollment period was from June 1995 through April 1996. The 27 patients with cirrhosis who did not have transplantation provided one random plasma sample. The 17 patients who had orthotopic liver transplantations had plasma samples taken before transplantation; within 4 to 12 hours after transplantation; and every Monday, Wednesday, and Friday thereafter until discharge or until the platelet count was normal. This schedule was adopted from previous studies of patients who had bone marrow transplantation [11]. Platelet counts were obtained daily for all 17 patients until discharge, as per standard protocol for orthotopic liver transplantation. The samples were frozen at 80C before being measured. Two enzyme-linked immunosorbent assays (ELISAs) were used during the study. The initial assay used a chimeric molecule that consisted of c-mpl extracellular domain fused to the Fc portion of human immunoglobulin for capture and a rabbit polyclonal antibody to thrombopoietin for detection. The second was a murine antithrombopoietin monoclonal antibody sandwich-type assay. The detection limits of the assays were 160 and 40 pg/mL, respectively. The second ELISA was available for the final 13 patients with cirrhosis and 10 patients who had liver transplantation. Cirrhotic liver samples were obtained from explanted livers during surgery (n = 9). Samples of livers from controls were obtained during partial hepatectomy for localized metastases of colon cancer (n = 5) or primary liver cancer (n = 2; 1 patient had leiomyosarcoma, and 1 had hepatoma) and during orthotopic liver transplantation for hereditary hyperoxaluria (n = 1). Liver tissue was obtained from areas of normal-appearing parenchyma. All patients had normal platelet counts, prothrombin times, and aminotransferase levels. Samples were snap-frozen in liquid nitrogen and stored at 80C. Total RNA was isolated from cryopreserved liver tissue by using the ULTRASPEC RNA Isolation System (Biotecx Lab, Houston, Texas) according to the manufacturers instructions. Reverse-transcription polymerase chain reaction (PCR) was done using 100 ng of total RNA, a thrombopoietin-specific reverse primer, and the Promega Access RT-PCR system (Promega, Madison, Wisconsin). The Perkin Elmer 7700 Sequence Detector System (Perkin Elmer, Foster City, Caliornia) was used for DNA amplification as described elsewhere [12]. The thrombopoietin-specific forward primer was 5GCCAAGATTCCTGGTCTGCTGAAC3, and the reverse primer was 5GCTGATGTCGGCAGTGTCTGAGAA3. A fluorogenic probe specific for thrombopoietin (5FAM-TGCCTGGACCAAATCCCGGATACCTGAA3) was added to the PCR amplification. Repetitive cycles resulted in increasing release of fluorescence. System software used fluorescence intensity to determine mRNA levels in thrombopoietin and in glyceraldehyde-3-phosphate dehydrogenase (a housekeeping gene). Funding provided by the National Institutes of Health and Genentech. Inc., had no influence on design of the study, conduct of the study, or reporting of the findings. Results Selected patient characteristics are shown in the (Table 1). All patients had moderate-to-severe liver dysfunction. Thrombocytopenia was profound in most patients; 21 patients had platelet counts less than 50 000/L, and 6 patients had counts less than 30 000/L. All 17 patients had successful transplantation without serious complications. Liver biopsies were done approximately 8 days (range, 6 to 16 days) after transplantation. Results showed no evidence of acute rejection (11 patients), mild rejection (4 patients), or moderate rejection (2 patients). Preservation injury was mild to moderate in all 17 patients, and all 17 had improved liver function after transplantation (data not shown). Table 1. Patient Characteristics Baseline levels of thrombopoietin were undetectable in 39 of 43 patients with cirrhosis. The mean detectable level of thrombopoietin was 130 pg/mL in 5 patients, and all levels were less than 200 pg/mL. In patients who had orthotopic liver transplantation, the mean interval to first detection of thrombopoietin was about 3 days and peak levels occurred about 8 days after transplantation. Peak concentrations of thrombopoietin varied considerably (46 to 2541 pg/mL), with a mean peak value of 492 pg/mL (median, 339 pg/mL). Platelet counts increased during or immediately after peak concentrations of thrombopoietin. Thrombocytopenia completely resolved in all 17 patients within 23 days after transplantation (10 patients before discharge, and 7 patients after discharge). As platelet counts reached normal levels, most patients (8 of 10) developed low or undetectable levels of thrombopoietin. A representative graph of thrombopoietin levels and platelet counts in 1 patient who had orthotopic liver transplantation is shown in the (Figure 1). Figure 1. Serial thrombopoietin levels and platelet counts before and after orthotopic liver transplantation. The ratio of thrombopoietin mRNA transcript levels to glyceraldehyde-3-phosphate dehydrogenase mRNA transcript levels was 0.264 in cirrhotic liver samples and 0.357 in control liver samples. Results are expressed as ratios to control for the number of liver cells. Thrombopoietin mRNA transcript levels were 26% lower in cirrhotic liver samples than in control liver samples (unpaired t-test, P = 0.0103 [95% CI, 0.025 to 0.161]). Discussion The mechanism (or mechanisms) responsible for homeostasis of thrombopoietin has not been fully elucidated. One model proposes that regulation occurs solely through binding of thrombopoietin to receptors on platelets [13, 14]. Receptors have the ability to bind, internalize, and degrade thrombopoietin. When platelet counts are normal (>140 000/microL), most thrombopoietin is bound to receptors and plasma levels are low. When platelet counts are low (<140 000 cells/microL), few receptors are available for binding with thrombopoietin and plasma levels increase. Elevated levels of thrombopoietin then stimulate megakaryopoiesis and platelet production. This model establishes an inverse relation between thrombopoietin levels and platelet counts. We previously [11] reported undetectable levels of thrombopoietin (<160 pg/mL) in plasma in 88 of 89 healthy persons and markedly increased plasma thrombopoietin levels in 58 of 61 patients with cancer and thrombocytopenia (mean thrombopoietin level, 1095 pg/mL); these findings support an inverse relation. On the basis of this model, we expected elevated levels of thrombopoietin in cirrhotic patients who had thrombocytopenia. On the contrary, we found low or undetectable levels, which suggests that thrombopoietin levels and platelet counts are not inversely related in patients with cirrhosis. Several explanations may account for this. One hypothesis is that synthesis of thrombopoietin is impaired in cirrhotic livers. Defective production of thrombopoietin results in lower serum levels, decreased megakaryopoiesis, and lower platelet counts. Another explanation is that hypersplenism causes thrombocytopenia and production of thrombopoietin is normal. As a result, thrombopoietin is bound to platelets and both are sequestered in the spleen. The persistent thrombocytopenia found in patients with cirrhosis after splenectomy or portal decompression procedures argues against this explanation. A third possibility is that thrombopoietin levels and platelet counts are low because of rapid destruction of platelets. Low levels of thrombopoietin have been described in persons with idiopathic thrombocytopenic purpura [15]. The low levels probably result from binding thrombopoietin to platelets and subsequent rapid destruction of platelets (and thrombopoietin) in the spleen. Rapid destruction of platelets is unlikely in patients with cirrhosis because nuclear medicine studies of such patients [1] have demonstrated normal or only slightly decreased platelet survival. We did measure thrombopoietin levels in five patients who had cirrhosis and normal platelet c

Characterization of a human Kaposi's sarcoma cell line that induces angiogenic tumors in animals.

ObjectiveTo characterize a Kaposis sarcoma (KS) cell line established from a tumor biopsy from the oral mucosa of an iatrogenically immunosuppressed HIV-negative man. MethodsCells were placed in culture and evaluated by a variety of biologic, serologic, karyotypic, and immunologic procedures. Electron microscopic examination was performed. The ability to produce tumors in nude mice was evaluated, and the nature of the cells within the tumor determined. Assays for urokinase plasminogen activator type (uPA), plasminogen activator inhibitor-1 (PAI-1) and the urokinase receptor (uPAR) were conducted. ResultsThe SLK cell line has an endothelial cell morphology with very little anaplasia. The karyotype indicates diploid phenotype of human origin. Immunohistochemical and electron microscopic examinations confirmed the endothelial nature of this cell line. No viruses were detected. The tumors induced in nude mice showed hypervascularization, with characteristics of KS. The cell line produces uPA and PAI-1, and also expresses uPAR. ConclusionsThe SLK cell line is of endothelial cell origin and the first human cell line to induce KS-like tumors in recipient animals. The expression of urokinase and its receptor suggests a paracrine and autocrine interaction that may be important for the growth of the tumor. The SLK line should be valuable for studies of KS pathogenesis and therapeutic approaches to this malignancy.

Protein Biomarker Identification in the CSF of Patients With CNS Lymphoma

PURPOSE Elucidation of the CSF proteome may yield insights into the pathogenesis of CNS disease. We tested the hypothesis that individual CSF proteins distinguish CNS lymphoma from benign focal brain lesions. METHODS We used a liquid chromatography/mass spectrometry-based method to differentially quantify and identify several hundred CSF proteins in CNS lymphoma and control patients. We used enzyme-linked immunosorbent assay (ELISA) to confirm one of these markers in an additional validation set of 101 cases. RESULTS Approximately 80 CSF proteins were identified and found to be present at significantly different concentrations, both higher and lower, in training and test studies, which were highly concordant. To further validate these observations, we defined in detail the expression of one of these candidate biomarkers, antithrombin III (ATIII). ATIII RNA transcripts were identified within CNS lymphomas, and ATIII protein was localized selectively to tumor neovasculature. Determination of ATIII concentration by ELISA was significantly more accurate (> 75% sensitivity; > 98% specificity) than cytology in the identification of cancer. Measurement of CSF ATIII levels was found to potentially enhance the ability to diagnose and predict outcome. CONCLUSION Our findings demonstrate for the first time that proteomic analysis of CSF yields individual biomarkers with greater sensitivity in the identification of cancer than does CSF cytology. We propose that the discovery of CSF protein biomarkers will facilitate early and noninvasive diagnosis in patients with lesions not amenable to brain biopsy, as well as provide improved surrogates of prognosis and treatment response in CNS lymphoma and brain metastasis.

Incorporation of intravenously injected albumin, immunoglobulin G, and fibrinogen in guinea pig megakaryocyte granules.

In a previous study we provide evidence for a circuitous pathway by which circulating plasma proteins enter megakaryocyte granules by an endocytic mechanism and are returned to the circulation in platelets (1987. Proc. Natl. Acad. Sci. USA. 84:861-865). Horseradish peroxidase (40,000 mol wt) was injected into guinea pigs and its uptake into megakaryocyte organelles examined by electron microscopy and cytochemistry. In the present study we tested the ability of guinea pig megakaryocytes to take up intravenously injected albumin, IgG, and fibrinogen. We used two types of proteins to study the endocytic pathway: (a) heterologous human proteins, which were detected immunohistochemically using antibodies that do not crossreact with the native guinea pig counterparts; and (b) human and guinea pig proteins labeled with the small (250 mol wt), inert molecule, biotin, which were detected using an antibody against biotin. We detected all three of the injected proteins in bone marrow megakaryocytes in patterns identical to those of native counterparts. The injected protein consistently appeared in platelets 24 h later and was secreted in response to thrombin. We conclude that there are at least two mechanisms by which guinea pig megakaryocyte granules acquire proteins (a) endogenous synthesis, as demonstrated by others, and (b) endocytosis of plasma proteins synthesized by other types of cells.