Robert L. Cohen

Genomic amplification of a decoy receptor for Fas ligand in lung and colon cancer

Fas ligand (FasL) is produced by activated T cells and natural killer cells and it induces apoptosis (programmed cell death) in target cells through the death receptor Fas/Apo1/CD95 (ref. 1). One important role of FasL and Fas is to mediate immune-cytotoxic killing of cells that are potentially harmful to the organism, such as virus-infected or tumour cells. Here we report the discovery of a soluble decoy receptor, termed decoy receptor 3 (DcR3), that binds to FasL and inhibits FasL-induced apoptosis. The DcR3 gene was amplified in about half of 35 primary lung and colon tumours studied, and DcR3 messenger RNA was expressed in malignant tissue. Thus, certain tumours may escape FasL-dependent immune-cytotoxic attack by expressing a decoy receptor that blocks FasL.

Stimulation of Megakaryocyte and Platelet Production by a Single Dose of Recombinant Human Thrombopoietin in Patients with Cancer

Thrombocytopenia is an important clinical problem in the management of patients in hematology and oncology practices. In the United States, the use of platelet transfusions to manage severe thrombocytopenia has steadily increased: Approximately 4 million units were transfused in 1982, and more than 8 million units were transfused in 1992 [1, 2]. This marked increase in the need for platelets has paralleled advances in organ transplantation, bone marrow transplantation, cardiac surgery, and the use of dose-intensive therapy in the treatment of chemosensitive malignant conditions. Although platelet transfusions may decrease the risk for fatal bleeding complications, repeated transfusions increase the risk for transmission of bacterial and viral pathogens, transfusion reactions, and transfusion-associated graft-versus-host disease. These transfusions also contribute to increasing health care costs and inconvenience to patients [3]. Thus, an agent that can increase platelet production and prevent or attenuate thrombocytopenia would be an important advance. Thrombopoietin, the ligand for the c-Mpl receptor (found on platelets and megakaryocyte progenitors), was recently cloned by several investigators and was shown to be a primary regulator of platelet production in vivo [4-8]. Thrombopoietin promotes both the proliferation of megakaryocyte progenitors and their maturation into platelet-producing megakaryocytes. In preclinical studies done in normal mice and nonhuman primates, thrombopoietin increased platelet counts to a level higher than those previously achieved with other thrombopoietic cytokines [9, 10]. Moreover, in a murine model for myelosuppression, recombinant thrombopoietin given as a single dose decreased the nadir and accelerated platelet recovery in mice that had been rendered pancytopenic by sublethal radiation and chemotherapy [11]. In these studies, more prolonged treatment (for as long as 8 days) provided no additional benefit and was associated with marked thrombocytosis during the recovery phase. On the basis of these observations, we initiated a phase I and II clinical and laboratory investigation of recombinant human thrombopoietin in patients with cancer who were at high risk for severe chemotherapy-induced thrombocytopenia. This trial was divided into two parts: Part I studied thrombopoietin given before chemotherapy, and part II studied thrombopoietin given after chemotherapy. The objective of part I, the results of which are reported here, was to assess the hematopoietic effects, pharmacodynamics, and clinical tolerance of this novel agent in patients who had normal hematopoietic function before chemotherapy. Methods Patients Patients with sarcoma who had never had chemotherapy, were suitable candidates for subsequent chemotherapy, and did not have rapidly progressive disease were eligible for this trial. Patients were required to have a Karnofsky performance status score of 80 or more, adequate bone marrow (absolute neutrophil count 1.5 109/L; platelet count 150 109/L and 450 109/L), adequate renal function (serum creatinine level 120 mol/L), and adequate hepatic function (alanine aminotransferase level < 3 times normal; bilirubin level < 1.5 times normal). Patients with a history of thromboembolic or bleeding disorders, significant cardiac disease, or previous pelvic radiation were excluded. Written informed consent was obtained from all patients before study entry in accordance with institutional guidelines. Design During the phase I dose-ranging portion of this clinical cohort study, thrombopoietin was administered as a single intravenous dose 3 weeks before chemotherapy. At study entry, three patients were assigned to each of four dose levels (0.3, 0.6, 1.2, and 2.4 g/kg of body weight). Patients who had no dose-limiting toxicity and did not develop neutralizing antibodies to thrombopoietin were eligible to receive thrombopoietin at the same doses after chemotherapy. Recombinant Human Thrombopoietin The thrombopoietin used in this study was provided by Genentech, Inc. (South San Francisco, California). Thrombopoietin is a full-length glycosylated molecule produced in a genetically modified mammalian cell line and purified by standard techniques. It was mixed with preservative-free normal saline as a diluent for injections. Clinical and Laboratory Monitoring Before and during the clinical trial, patients were monitored by complete histories; physical examinations; and laboratory tests, including a complete blood cell count with differential counts, serum chemistry, coagulation profile, urinalysis, assessment of thrombopoietin antibody formation, chest radiography, and electrocardiography. Blood counts were obtained daily for the first 5 days and then at least three times per week. Peripheral smears were examined serially for platelet morphology. Platelet counts and the average size of platelets (mean platelet volume) were derived from 64-channel platelet histograms. Bone marrow aspiration and biopsy were done before and 1 week after thrombopoietin treatment. The bone marrow specimens were initially fixed in 10% neutral formalin, embedded in paraffin, cut into sections 5 m thick, and stained with hematoxylin-eosin for morphologic analysis and with Masson trichrome for analysis of collagen fiber content. Fresh, air-dried smears of bone marrow were stained with Wright-Giemsa. Bone marrow samples were examined for overall cellularity and morphology in a blinded manner. Megakaryocyte counts were measured by choosing 10 high-power (40x) fields in areas without artifactual zones or trabecula. The relative size of the megakaryocyte was assessed by examining bone marrow aspirate smears using the Magiscan Image Analysis System (Compix, Cranberry, Pennsylvania). Bone marrow aspirates were also assayed for hematopoietic progenitor cell number and cycle status, for content of CD34+ and CD41+ cell subsets (by flow cytometry), and for megakaryocyte ploidy (by flow cytometry). Blood samples were assayed for hematopoietic progenitor cell number and for platelet function. Pharmacokinetics Profiles Serum samples were collected before and at 2, 5, 10, 60, and 90 minutes and 2, 4, 6, 8, 10, 12, 24, 48, 72, 96, and 120 hours after thrombopoietin administration. Concentration-time profile at each dose level was evaluated by using standard pharmacokinetics methods. Serum thrombopoietin levels were quantitated by enzyme-linked immunosorbent assay for thrombopoietin [12]. Hematopoietic Progenitor Cell Assays Assays for colony-forming unit-granulocyte-macrophage (CFU-GM); burst-forming unit-erythroid (BFU-E); and colony-forming unit-granulocyte, erythroid, macrophage, megakaryocyte (CFU-GEMM) using low-density bone marrow [13] and peripheral blood cells [14] were done with methyl cellulose assays. The percentage of bone marrow CFU-GM and BFU-E in DNA synthesis (S-phase of cell cycle) was measured by a high-specific-activity tritiated thymidine suicide technique [15]. Assays for colony-forming unit-megakaryocyte (CFU-MK) and burst-forming unit-megakaryocyte (BFU-MK) were done using a fibrin clot assay [16]. Ploidy Analysis Megakaryocyte-enriched cell fractions were prepared from bone marrow cell suspensions by using a Percoll gradient technique. Ploidy was determined by flow cytometric measurement of the relative DNA content after staining with propidium iodide in hypotonic citrate solution [17]. Cells were also stained with anti-CD41b (8D9)-FITC (SyStemix, Palo Alto, California) to allow gating on CD41b+ megakaryocytes. At least 3000 CD41+ events were collected for each sample. The percentage of CD41+ cells in ploidy class was determined from the fluorescence-activated cell-sorting dot plots. Platelet Function Platelet aggregation was measured in response to three agonists: adenosine diphosphate (final concentration, 20 g/mL), collagen (6 g/mL), and thrombin (5 g/mL). Standard methods were used [18]. The concentrations of agonists were chosen on the basis of previous in vitro studies done on blood from normal controls. The instruments used for the assays were the Bio/Data Pap 4A (Horsham, Pennsylvania) and the Crono-log 560CA (Havertown, Pennsylvania). Immunophenotypic Analysis Immunophenotypic analysis was done using anti-CD34 (Becton Dickinson, San Jose, California) and anti-CD41 monoclonal antibodies (Immunotech, Westbrook, Maine) by a standard dual-color flow cytometry technique [19]. Statistical Analysis Continuous variables were compared by using the Wilcoxon matched-pairs signed-rank test. Trends for possible dose-response relation were evaluated using the Spearman rank correlation coefficients (rS) between dose and outcome. Industry Role Thrombopoietin and partial funding for the study were provided by Genentech, Inc. The study was a collaborative effort between the principal investigator and the industrial sponsor. Data collection, data analysis, the writing of the manuscript, and the decision to publish the manuscript were under the control of the principal investigator. The manuscript was reviewed by the industrial sponsor before submission. Results Twelve chemotherapy-naive patients (7 men and 5 women) with sarcoma of diverse histologic sub-types were entered into the dose-ranging portion of this phase I trial, which studied thrombopoietin before chemotherapy. All patients were considered evaluable for clinical tolerance and response to thrombopoietin. The median age of these patients was 42 years (range, 16 to 63 years), and the median Karnofsky performance status score was 90 (range, 80 to 100). Four patients had previously received radiation therapy, and eight had previously had surgery. Peripheral Blood Counts Treatment with a single dose of thrombopoietin was associated with increases (1.3-fold to 3.6-fold) in platelet counts (baseline mean, 264 109/L; maximal mean, 592 109/L) (P = 0.002). The increase in platelet count was seen at all dose levels (Figure 1) in all patients. The peak response i

Thrombopoietin Levels in Patients with Cirrhosis before and after Orthotopic Liver Transplantation

Thrombocytopenia in patients with cirrhosis has historically been attributed to hypersplenism. Radiolabeled platelet studies have clearly demonstrated splenic sequestration in cirrhosis and have shown that up to 90% of platelets can localize to the spleen [1-3]. However, portal decompression procedures have failed to consistently improve thrombocytopenia [4-7] and thrombocytopenia can persist after splenectomy [8]. Therefore, other factors must be involved. Thrombopoietin is a potent stimulator of megakaryocyte growth and platelet production [9]. Synthesis of thrombopoietin probably occurs in the liver [10]. In this study, we measured plasma thrombopoietin levels in cirrhotic patients who had thrombocytopenia and evaluated changes in these levels throughout orthotopic liver transplantation. Levels of messenger RNA (mRNA) in thrombopoietin in liver samples taken from patients with cirrhosis and controls were compared. Our hypothesis was that production of thrombopoietin is altered in patients with cirrhosis and that impaired transcription of thrombopoietin mRNA may contribute to this alteration. Methods Two separate convenience samples taken from patients with cirrhosis (17 patients who had and 27 patients who did not have orthotopic liver transplantation) were recruited from the gastroenterology services at the University of California, San Francisco, Medical Center. All 44 patients had persistent or stable thrombocytopenia for more than 2 weeks (platelet count < 120 000 cells/microL). Patients with acute intercurrent illnesses were excluded. Patients were selected for transplantation on the basis of standard criteria (severity of disease and organ availability). These patients received an ABO-matched cadaver liver and standard post-transplantation immunosuppressive drugs, including corticosteroids, azathioprine, and cyclosporine. Approval was obtained from the Committee on Human Research at the University of California, San Francisco: all patients provided informed consent. The enrollment period was from June 1995 through April 1996. The 27 patients with cirrhosis who did not have transplantation provided one random plasma sample. The 17 patients who had orthotopic liver transplantations had plasma samples taken before transplantation; within 4 to 12 hours after transplantation; and every Monday, Wednesday, and Friday thereafter until discharge or until the platelet count was normal. This schedule was adopted from previous studies of patients who had bone marrow transplantation [11]. Platelet counts were obtained daily for all 17 patients until discharge, as per standard protocol for orthotopic liver transplantation. The samples were frozen at 80C before being measured. Two enzyme-linked immunosorbent assays (ELISAs) were used during the study. The initial assay used a chimeric molecule that consisted of c-mpl extracellular domain fused to the Fc portion of human immunoglobulin for capture and a rabbit polyclonal antibody to thrombopoietin for detection. The second was a murine antithrombopoietin monoclonal antibody sandwich-type assay. The detection limits of the assays were 160 and 40 pg/mL, respectively. The second ELISA was available for the final 13 patients with cirrhosis and 10 patients who had liver transplantation. Cirrhotic liver samples were obtained from explanted livers during surgery (n = 9). Samples of livers from controls were obtained during partial hepatectomy for localized metastases of colon cancer (n = 5) or primary liver cancer (n = 2; 1 patient had leiomyosarcoma, and 1 had hepatoma) and during orthotopic liver transplantation for hereditary hyperoxaluria (n = 1). Liver tissue was obtained from areas of normal-appearing parenchyma. All patients had normal platelet counts, prothrombin times, and aminotransferase levels. Samples were snap-frozen in liquid nitrogen and stored at 80C. Total RNA was isolated from cryopreserved liver tissue by using the ULTRASPEC RNA Isolation System (Biotecx Lab, Houston, Texas) according to the manufacturers instructions. Reverse-transcription polymerase chain reaction (PCR) was done using 100 ng of total RNA, a thrombopoietin-specific reverse primer, and the Promega Access RT-PCR system (Promega, Madison, Wisconsin). The Perkin Elmer 7700 Sequence Detector System (Perkin Elmer, Foster City, Caliornia) was used for DNA amplification as described elsewhere [12]. The thrombopoietin-specific forward primer was 5GCCAAGATTCCTGGTCTGCTGAAC3, and the reverse primer was 5GCTGATGTCGGCAGTGTCTGAGAA3. A fluorogenic probe specific for thrombopoietin (5FAM-TGCCTGGACCAAATCCCGGATACCTGAA3) was added to the PCR amplification. Repetitive cycles resulted in increasing release of fluorescence. System software used fluorescence intensity to determine mRNA levels in thrombopoietin and in glyceraldehyde-3-phosphate dehydrogenase (a housekeeping gene). Funding provided by the National Institutes of Health and Genentech. Inc., had no influence on design of the study, conduct of the study, or reporting of the findings. Results Selected patient characteristics are shown in the (Table 1). All patients had moderate-to-severe liver dysfunction. Thrombocytopenia was profound in most patients; 21 patients had platelet counts less than 50 000/L, and 6 patients had counts less than 30 000/L. All 17 patients had successful transplantation without serious complications. Liver biopsies were done approximately 8 days (range, 6 to 16 days) after transplantation. Results showed no evidence of acute rejection (11 patients), mild rejection (4 patients), or moderate rejection (2 patients). Preservation injury was mild to moderate in all 17 patients, and all 17 had improved liver function after transplantation (data not shown). Table 1. Patient Characteristics Baseline levels of thrombopoietin were undetectable in 39 of 43 patients with cirrhosis. The mean detectable level of thrombopoietin was 130 pg/mL in 5 patients, and all levels were less than 200 pg/mL. In patients who had orthotopic liver transplantation, the mean interval to first detection of thrombopoietin was about 3 days and peak levels occurred about 8 days after transplantation. Peak concentrations of thrombopoietin varied considerably (46 to 2541 pg/mL), with a mean peak value of 492 pg/mL (median, 339 pg/mL). Platelet counts increased during or immediately after peak concentrations of thrombopoietin. Thrombocytopenia completely resolved in all 17 patients within 23 days after transplantation (10 patients before discharge, and 7 patients after discharge). As platelet counts reached normal levels, most patients (8 of 10) developed low or undetectable levels of thrombopoietin. A representative graph of thrombopoietin levels and platelet counts in 1 patient who had orthotopic liver transplantation is shown in the (Figure 1). Figure 1. Serial thrombopoietin levels and platelet counts before and after orthotopic liver transplantation. The ratio of thrombopoietin mRNA transcript levels to glyceraldehyde-3-phosphate dehydrogenase mRNA transcript levels was 0.264 in cirrhotic liver samples and 0.357 in control liver samples. Results are expressed as ratios to control for the number of liver cells. Thrombopoietin mRNA transcript levels were 26% lower in cirrhotic liver samples than in control liver samples (unpaired t-test, P = 0.0103 [95% CI, 0.025 to 0.161]). Discussion The mechanism (or mechanisms) responsible for homeostasis of thrombopoietin has not been fully elucidated. One model proposes that regulation occurs solely through binding of thrombopoietin to receptors on platelets [13, 14]. Receptors have the ability to bind, internalize, and degrade thrombopoietin. When platelet counts are normal (>140 000/microL), most thrombopoietin is bound to receptors and plasma levels are low. When platelet counts are low (<140 000 cells/microL), few receptors are available for binding with thrombopoietin and plasma levels increase. Elevated levels of thrombopoietin then stimulate megakaryopoiesis and platelet production. This model establishes an inverse relation between thrombopoietin levels and platelet counts. We previously [11] reported undetectable levels of thrombopoietin (<160 pg/mL) in plasma in 88 of 89 healthy persons and markedly increased plasma thrombopoietin levels in 58 of 61 patients with cancer and thrombocytopenia (mean thrombopoietin level, 1095 pg/mL); these findings support an inverse relation. On the basis of this model, we expected elevated levels of thrombopoietin in cirrhotic patients who had thrombocytopenia. On the contrary, we found low or undetectable levels, which suggests that thrombopoietin levels and platelet counts are not inversely related in patients with cirrhosis. Several explanations may account for this. One hypothesis is that synthesis of thrombopoietin is impaired in cirrhotic livers. Defective production of thrombopoietin results in lower serum levels, decreased megakaryopoiesis, and lower platelet counts. Another explanation is that hypersplenism causes thrombocytopenia and production of thrombopoietin is normal. As a result, thrombopoietin is bound to platelets and both are sequestered in the spleen. The persistent thrombocytopenia found in patients with cirrhosis after splenectomy or portal decompression procedures argues against this explanation. A third possibility is that thrombopoietin levels and platelet counts are low because of rapid destruction of platelets. Low levels of thrombopoietin have been described in persons with idiopathic thrombocytopenic purpura [15]. The low levels probably result from binding thrombopoietin to platelets and subsequent rapid destruction of platelets (and thrombopoietin) in the spleen. Rapid destruction of platelets is unlikely in patients with cirrhosis because nuclear medicine studies of such patients [1] have demonstrated normal or only slightly decreased platelet survival. We did measure thrombopoietin levels in five patients who had cirrhosis and normal platelet c

Determination of HER2 Gene Amplification by Fluorescence In situ Hybridization and Concordance with the Clinical Trials Immunohistochemical Assay in Women with Metastatic Breast Cancer Evaluated for Treatment with Trastuzumab

SummaryPurpose. To evaluate the concordance between HER2 gene amplification, determined by fluorescence in situ hybridization (FISH), and HER2 protein overexpression assessed by an immunohistochemical (IHC) assay. The IHC protocol used was a research assay, known as the Clinical Trial Assay (CTA), developed to select women with metastatic breast cancer (MBC) for three pivotal clinical trials of trastuzumab therapy.Methods. A direct-labeled, dual-probe FISH assay was used to determine HER2 amplification in 623 fixed breast cancer tissue specimens. These specimens had been stored as paraffin-embedded sections for 2ᾢ5 years. All specimens had been analyzed for HER2 protein expression by the CTA. To assess the reproducibility of FISH results in archived material, we evaluated a separate group of 617 breast cancer tissue specimens at two di erent laboratories.Results. Informative FISH results were available for 529 (85%) of the 623 specimens. Overall concordance between FISH and IHC results was 82% (95% CI; 78ᾢ85%). Assay agreement between FISH results and specimens with immunostaining scores of 0, 1+, and 3+ were 97, 93 and 89%, respectively. However, only 24% of specimens with 2+ immunostaining scores had HER2 amplification by FISH; there was assay disagreement in 76% of specimens in this IHC subgroup. Interlaboratory FISH concordance was 92% (95% CI; 89ᾢ94%), indicating very good assay reproducibility in these archived specimens.Conclusion. HER2 status determined by CTA-IHC and FISH are significantly correlated; however, differences between these two assays can a ect patient selection for trastuzumab therapy.

Characterization of a human Kaposi's sarcoma cell line that induces angiogenic tumors in animals.

ObjectiveTo characterize a Kaposis sarcoma (KS) cell line established from a tumor biopsy from the oral mucosa of an iatrogenically immunosuppressed HIV-negative man. MethodsCells were placed in culture and evaluated by a variety of biologic, serologic, karyotypic, and immunologic procedures. Electron microscopic examination was performed. The ability to produce tumors in nude mice was evaluated, and the nature of the cells within the tumor determined. Assays for urokinase plasminogen activator type (uPA), plasminogen activator inhibitor-1 (PAI-1) and the urokinase receptor (uPAR) were conducted. ResultsThe SLK cell line has an endothelial cell morphology with very little anaplasia. The karyotype indicates diploid phenotype of human origin. Immunohistochemical and electron microscopic examinations confirmed the endothelial nature of this cell line. No viruses were detected. The tumors induced in nude mice showed hypervascularization, with characteristics of KS. The cell line produces uPA and PAI-1, and also expresses uPAR. ConclusionsThe SLK cell line is of endothelial cell origin and the first human cell line to induce KS-like tumors in recipient animals. The expression of urokinase and its receptor suggests a paracrine and autocrine interaction that may be important for the growth of the tumor. The SLK line should be valuable for studies of KS pathogenesis and therapeutic approaches to this malignancy.

Circulating thrombopoietin concentrations in thrombocytopenic patients, including cancer patients following chemotherapy, with or without peripheral blood progenitor cell transplantation

Thrombopoietin, the ligand for the c‐mpl receptor, promotes proliferation and maturation of megakaryocytes. An ELISA using a chimaeric receptor, mpl‐IgG, for capture, and rabbit antibody to thrombopoietin for detection was developed for the quantitation of thrombopoietin in human serum or plasma. This ELISA preferentially detects full‐length thrombopoietin compared to the bioactive N‐terminal half of the molecule which has homology to erythropoietin. Thrombopoietin was not detected (<0.16 ng/ml) in 88/89 healthy individuals. However, elevated thrombopoietin concentrations of up to 3 ng/ml were detected in 59/63 thrombocytopenic patients, including cancer patients following chemotherapy. In cancer patients receiving chemotherapy with (n = 12) or without (n = 6) peripheral blood progenitor cell transplantation, thrombopoietin concentrations varied inversely with platelet counts throughout the treatment period. In general, patients who received myeloablative chemotherapy on days −7 to −2 and peripheral blood progenitor cell transplantation on day 0 had high thrombopoietin levels (0.6–2.9 ng/ml) around day 5. Low platelet counts (<20 × 109/l) occurred between days 4 and 9. Patients who received high‐dose chemotherapy on day 1 (equivalent to day −7 for transplantation patients) to day 6 without transplantation had high thrombopoietin concentrations (1.4–2.3 ng/ml) around day 13 and low platelet counts occurred between days 7 and 17.

A novel anti-CD22 anthracycline-based antibody-drug conjugate (ADC) that overcomes resistance to auristatin based ADCs

Purpose: We are interested in identifying mechanisms of resistance to the current generation of antibody–drug conjugates (ADC) and developing ADCs that can overcome this resistance. Experimental Design: Pinatuzumab vedotin (anti-CD22-vc-MMAE) and polatuzumab vedotin (anti-CD79b-vc-MMAE) are ADCs that contain the microtubule inhibitor monomethyl auristatin E (MMAE) attached to the antibody by the protease-cleavable linker maleimidocaproyl-valine-citrulline-p-aminobenzoyloxycarbonyl (MC-vc-PAB). Early clinical trial data suggest that these ADCs have promising efficacy for the treatment of non-Hodgkin lymphoma (NHL); however, some patients do not respond or become resistant to the ADCs. Anthracyclines are very effective in NHL, but ADCs containing the anthracycline doxorubicin were not clinically efficacious probably due to the low drug potency and inadequate linker technology. The anthracycline analogue PNU-159682 is thousands of times more cytotoxic than doxorubicin, so we used it to develop a new class of ADCs. We used the same MC-vc-PAB linker and antibody in pinatuzumab vedotin but replaced the MMAE with a derivative of PNU-159682 to make anti-CD22-NMS249 and tested it for in vivo efficacy in xenograft tumors resistant to MMAE-based ADCs. Results: We derived cell lines from in vivo xenograft tumors that were made resistant to anti-CD22-vc-MMAE and anti-CD79b-vc-MMAE. We identified P-gp (ABCB1/MDR1) as the major driver of resistance to the vc-MMAE–based conjugates. Anti-CD22-NMS249 was at least as effective as anti-CD22-vc-MMAE in xenograft models of the parental cell lines and maintained its efficacy in the resistant cell lines. Conclusions: These studies provide proof of concept for an anthracycline-based ADC that could be used to treat B-cell malignancies that are resistant to vc-MMAE conjugates. Clin Cancer Res; 21(14); 3298–306. ©2015 AACR.

Decrease in tumor apparent permeability-surface area product to a MRI macromolecular contrast medium following angiogenesis inhibition with correlations to cytotoxic drug accumulation.

Background: New strategies for cancer therapy include the combination of angiogenesis inhibitors with cytotoxins. However, angiogenesis inhibitors may alter tumor microvessel structure and transendothelial permeability thereby reducing tumoral delivery of cytotoxic agents. The aim of this study was to estimate quantitatively the apparent permeability‐surface area product (KPS) in tumors to a macromolecular contrast medium (MMCM), to follow changes in KPS induced by antibodies to vascular endothelial growth factor (anti‐VEGF), and to correlate the findings with tumor accumulation of cisplatin, a highly protein‐bound cytotoxin, and 5‐fluorouracil (5‐FU), a small unbound cytotoxin.

Abstract 4634: Anthracycline based antibody-drug conjugates (ADCs) for the treatment of non-Hodgkin's lymphoma are effective in cell lines resistant to auristatin based ADCs.

Proceedings: AACR 104th Annual Meeting 2013; Apr 6-10, 2013; Washington, DC Anthracyclines are one of the most widely used classes of chemotherapy. With current success of antibody drug conjugates in the clinic, we were interested in anthracycline-based antibody-drug conjugates (ADCs). Anthracyclines currently used in systemic chemotherapy were ineffective as the ADC drug probably due to low potency of the drug. PNU-159682 was identified as a metabolic product of nemorubicin that was 700 to 2400 more potent in in vivo cytotoxicity assays than nemorubicin. We were interested to see if we could develop an effective anthracycline-based ADC using PNU-159682. For these proof of concept studies we selected the clinically validated linker maleimidocaproyl-valine-citrulline-p-aminobenzoyloxycarbonyl (MC-vc-PAB) used in the approved ADC brentuximab vedotin [anti-CD30-MC-vc-PAB-monomethyl auristatin E (MMAE)] and attached it to the primary alcohol of PNU-159682 to make NMS-249. For antibodies we selected the anti-CD22 and anti-CD79b antibodies that have been shown to be effective as MC-vc-PAB-MMAE ADCs in phase 1 clinical trials for the treatment of NHL. In xenograft models of NHL anti-CD22-NMS249 was as effective or more effective as anti-CD22-MC-vcPAB-MMAE. In particular WSU-DLCL2, where anti-CD22-MC-vc-PAB-MMAE was least effective, show the greatest difference between the two ADCs. To further explore if these the anti-CD22-NMS249 could be used for patients that had progressed on auristatin-based ADC, we developed two cell lines that were resistant to anti-CD22-MC-vc-PAB-MMAE by consistently treating xenograft models with increase amounts of ADC. After removing the resistant tumors and culturing the cells in vitro the cell lines retained their resistance in vivo to anti-CD22-MC-vc-PAB-MMAE but were also resistance to anti-CD79b-MC-vc-PAB-MMAE. This suggests the resistance was not target related and we found that CD22 expression was maintained in the resistant cell lines. Anti-CD22-NMS249 maintained its efficacy in the resistant cell lines. Microarray and FACs showed that the resistant cells lines were up-regulated in MDR1 (PgP). We found that in vivo, unlike other anthacyclines, PNU-159682 was not a PgP substrate this may explain the ability of the anti-CD22-NMS249 to overcome the resistance to anti-CD22-MC-vc-PAB-MMAE. These studies provide poof of concept for an anthracycline ADC that could be use in patients that have failed auristatin-based therapies. Citation Format: Andrew G. Polson, Bing Zheng, MaryAnn Go, Jeffery Lau, Shang-Fan Yu, Susan Spencer, Robert Cohen, Michele Caruso, John Flygare, Paul Polakis. Anthracycline based antibody-drug conjugates (ADCs) for the treatment of non-Hodgkins lymphoma are effective in cell lines resistant to auristatin based ADCs. [abstract]. In: Proceedings of the 104th Annual Meeting of the American Association for Cancer Research; 2013 Apr 6-10; Washington, DC. Philadelphia (PA): AACR; Cancer Res 2013;73(8 Suppl):Abstract nr 4634. doi:10.1158/1538-7445.AM2013-4634