Marie Mangelsdorf

Ancient missense mutations in a new member of the RoRet gene family are likely to cause Familial Mediterranean Fever

Familial Mediterranean fever (FMF) is a recessively inherited disorder characterized by dramatic episodes of fever and serosal inflammation. This report describes the cloning of the gene likely to cause FMF from a 115-kb candidate interval on chromosome 16p. Three different missense mutations were identified in affected individuals, but not in normals. Haplotype and mutational analyses disclosed ancestral relationships among carrier chromosomes in populations that have been separated for centuries. The novel gene encodes a 3.7-kb transcript that is almost exclusively expressed in granulocytes. The predicted protein, pyrin, is a member of a family of nuclear factors homologous to the Ro52 autoantigen. The cloning of the FMF gene promises to shed light on the regulation of acute inflammatory responses.Familial Mediterranean fever (FMF) is a recessively inherited disorder characterized by dramatic episodes of fever and serosal inflammation. This report describes the cloning of the gene likely to cause FMF from a 115-kb candidate interval on chromosome 16p. Three different missense mutations were identified in affected individuals, but not in normals. Haplotype and mutational analyses disclosed ancestral relationships among carrier chromosomes in populations that have been separated for centuries. The novel gene encodes a 3.7-kb transcript that is almost exclusively expressed in granulocytes. The predicted protein, pyrin, is a member of a family of nuclear factors homologous to the Ro52 autoantigen. The cloning of the FMF gene promises to shed light on the regulation of acute inflammatory responses.

Mutations in the human ortholog of Aristaless cause X-linked mental retardation and epilepsy

Mental retardation and epilepsy often occur together. They are both heterogeneous conditions with acquired and genetic causes. Where causes are primarily genetic, major advances have been made in unraveling their molecular basis. The human X chromosome alone is estimated to harbor more than 100 genes that, when mutated, cause mental retardation. At least eight autosomal genes involved in idiopathic epilepsy have been identified, and many more have been implicated in conditions where epilepsy is a feature. We have identified mutations in an X chromosome–linked, Aristaless-related, homeobox gene (ARX), in nine families with mental retardation (syndromic and nonspecific), various forms of epilepsy, including infantile spasms and myoclonic seizures, and dystonia. Two recurrent mutations, present in seven families, result in expansion of polyalanine tracts of the ARX protein. These probably cause protein aggregation, similar to other polyalanine and polyglutamine disorders. In addition, we have identified a missense mutation within the ARX homeodomain and a truncation mutation. Thus, it would seem that mutation of ARX is a major contributor to X-linked mental retardation and epilepsy.

Human Chromosomal Fragile Site FRA16B Is an Amplified AT-Rich Minisatellite Repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)n trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATA TTATATATTATATCTAATAATATATC/ATA)n (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Infantile spasms, dystonia, and other X-linked phenotypes caused by mutations in Aristaless related homeobox gene, ARX

Clinical data from 50 mentally retarded (MR) males in nine X-linked MR families, syndromic and non-specific, with mutations (duplication, expansion, missense, and deletion mutations) in the Aristaless related homeobox gene, ARX, were analysed. Seizures were observed with all mutations and occurred in 29 patients, including one family with a novel myoclonic epilepsy syndrome associated with the missense mutation. Seventeen patients had infantile spasms. Other phenotypes included mild to moderate MR alone, or with combinations of dystonia, ataxia or autism. These data suggest that mutations in the ARX gene are important causes of MR, often associated with diverse neurological manifestations.

Mutations in the DLG3 Gene Cause Nonsyndromic X-Linked Mental Retardation

We have identified truncating mutations in the human DLG3 (neuroendocrine dlg) gene in 4 of 329 families with moderate to severe X-linked mental retardation. DLG3 encodes synapse-associated protein 102 (SAP102), a member of the membrane-associated guanylate kinase protein family. Neuronal SAP102 is expressed during early brain development and is localized to the postsynaptic density of excitatory synapses. It is composed of three amino-terminal PDZ domains, an src homology domain, and a carboxyl-terminal guanylate kinase domain. The PDZ domains interact directly with the NR2 subunits of the NMDA glutamate receptor and with other proteins responsible for NMDA receptor localization, immobilization, and signaling. The mutations identified in this study all introduce premature stop codons within or before the third PDZ domain, and it is likely that this impairs the ability of SAP102 to interact with the NMDA receptor and/or other proteins involved in downstream NMDA receptor signaling pathways. NMDA receptors have been implicated in the induction of certain forms of synaptic plasticity, such as long-term potentiation and long-term depression, and these changes in synaptic efficacy have been proposed as neural mechanisms underlying memory and learning. The disruption of NMDA receptor targeting or signaling, as a result of the loss of SAP102, may lead to altered synaptic plasticity and may explain the intellectual impairment observed in individuals with DLG3 mutations.

FRA10B Structure Reveals Common Elements in Repeat Expansion and Chromosomal Fragile Site Genesis

A common mechanism for chromosomal fragile site genesis is not yet apparent. Folate-sensitive fragile sites are expanded p(CCG)n repeats that arise from longer normal alleles. Distamycin A or bromodeoxyuridine-inducible fragile site FRA16B is an expanded AT-rich approximately 33 bp repeat; however, the relationship between normal and fragile site alleles is not known. Here, we report that bromodeoxyuridine-inducible, distamycin A-insensitive fragile site FRA10B is composed of expanded approximately 42 bp repeats. Differences in repeat motif length or composition between different FRA10B families indicate multiple independent expansion events. Some FRA10B alleles comprise a mixture of different expanded repeat motifs. FRA10B fragile site and long normal alleles share flanking polymorphisms. Somatic and intergenerational FRA10B repeat instability analogous to that found in expanded trinucleotide repeats supports dynamic mutation as a common mechanism for repeat expansion.

Aristaless-related homeobox gene, the gene responsible for West syndrome and related disorders, is a Groucho/transducin-like enhancer of split dependent transcriptional repressor

Aristaless-related homeobox gene (ARX) is an important paired-type homeobox gene involved in the development of human brain. The ARX gene mutations are a significant contributor to various forms of X-chromosome-linked mental retardation with and without additional features including epilepsy, lissencephaly with abnormal genitalia, hand dystonia or autism. Here we demonstrate that the human ARX protein is a potent transcriptional repressor, which binds to Groucho/transducin-like enhancer of split (TLE) co-factor proteins and the TLE1 in particular through its octapeptide (Engrailed homology repressor domain (eh-1) homology) domain. We show that the transcription repression activity of ARX is modulated by two strong repression domains, one located within the octapeptide domain and the second in the region of the polyalanine tract 4, and one activator domain, the aristaless domain. Importantly, we show that the transcription repression activity of ARX is affected by various naturally occurring mutations. The introduction of the c.98T>C (p.L33P) mutation results in the lack of binding to TLE1 protein and relaxed transcription repression. The introduction of the two most frequent ARX polyalanine tract expansion mutations increases the repression activity in a manner dependent on the number of extra alanines. Interestingly, deletions of alanine residues within polyalanine tracts 1 and 2 show low or no effect. In summary we demonstrate that the ARX protein is a strong transcription repressor, we identify novel ARX interacting proteins (TLE) and offer an explanation of a molecular pathogenesis of some ARX mutations, including the most frequent ARX mutations, the polyalanine tract expansion mutations, c.304ins(GCG)7 and c.428_451dup.

Identification of RNA bound to the TDP-43 ribonucleoprotein complex in the adult mouse brain

Abstract Cytoplasmic inclusions containing TDP-43 are a pathological hallmark of several neurodegenerative disorders, including amyotrophic lateral sclerosis (ALS) and frontotemporal dementia. TDP-43 is an RNA binding protein involved in gene regulation through control of RNA transcription, splicing and transport. However, the function of TDP-43 in the nervous system is largely unknown and its role in the pathogenesis of ALS is unclear. The aim of this study was to identify genes in the central nervous system that are regulated by TDP-43. RNA-immunoprecipitation with anti-TDP-43 antibody, followed by microarray analysis (RIP-chip), was used to isolate and identify RNA bound to TDP-43 protein from mouse brain. This analysis produced a list of 1839 potential TDP-43 gene targets, many of which overlap with previous studies and whose functions include RNA processing and synaptic function. Immunohistochemistry demonstrated that the TDP-43 protein could be found at the presynaptic membrane of axon terminals in the neuromuscular junction in mice. In conclusion, the finding that TDP-43 binds to RNA that codes for genes related to synaptic function, together with the localization of TDP-43 protein at axon terminals, suggests a role for TDP-43 in the transport of synaptic mRNAs into distal processes.

RNA-binding proteins in neurological diseases.

Emerging studies support that RNA-binding proteins (RBPs) play critical roles in human biology and pathogenesis. RBPs are essential players in RNA processing and metabolism, including pre-mRNA splicing, polyadenylation, transport, surveillance, mRNA localization, mRNA stability control, translational control and editing of various types of RNAs. Aberrant expression of and mutations in RBP genes affect various steps of RNA processing, altering target gene function. RBPs have been associated with various diseases, including neurological diseases. Here, we mainly focus on selected RNA-binding proteins including Nova-1/Nova-2, HuR/HuB/HuC/HuD, TDP-43, Fus, Rbfox1/Rbfox2, QKI and FMRP, discussing their function and roles in human diseases.

XLMR in MRX families 29, 32, 33 and 38 results from the dup24 mutation in the ARX (Aristaless related homeobox) gene

BackgroundX-linked mental retardation (XLMR) is the leading cause of mental retardation in males. Mutations in the ARX gene in Xp22.1 have been found in numerous families with both nonsyndromic and syndromic XLMR. The most frequent mutation in this gene is a 24 bp duplication in exon 2. Based on this fact, a panel of XLMR families linked to Xp22 was tested for this particular ARX mutation.MethodsGenomic DNA from XLMR families linked to Xp22.1 was amplified for exon 2 in ARX using a Cy5 labeled primer pair. The resulting amplicons were sized using the ALFexpress automated sequencer.ResultsA panel of 11 families with X-linked mental retardation was screened for the ARX 24dup mutation. Four nonsyndromic XLMR families – MRX29, MRX32, MRX33 and MRX38 – were found to have this particular gene mutation.ConclusionWe have identified 4 additional XLMR families with the ARX dup24 mutation from a panel of 11 XLMR families linked to Xp22.1. This finding makes the ARX dup24 mutation the most common mutation in nonsyndromic XLMR families linked to Xp22.1. As this mutation can be readily tested for using an automated sequencer, screening should be considered for any male with nonsyndromic MR of unknown etiology.