Min-Ting Lin

Molecular analysis of SMN1, SMN2, NAIP, GTF2H2, and H4F5 genes in 157 Chinese patients with spinal muscular atrophy.

Spinal muscular atrophy (SMA) is a common and lethal autosomal recessive neurodegenerative disorder, which is caused by mutations of the survival motor neuron 1 (SMN1) gene. Additionally, the phenotype is modified by several genes nearby SMN1 in the 5q13 region. In this study, we analyzed mutations in SMN1 and quantified the modifying genes, including SMN2, NAIP, GTF2H2, and H4F5 by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP), multiplex ligation-dependent probe amplification (MLPA), TA cloning, allele-specific long-range PCR, and Sanger sequencing in 157 SMA patients. Most SMA patients (94.90%) possessed a homozygous SMN1 deletion, while 10 patients demonstrated only the absence of exon 7, but the presence of exon 8. Two missense mutations (c.689 C>T and c.844 C>T) were identified in 2 patients who both carried a single copy of SMN1. We found inverse correlations between SMN2, the NAIP copy number, and the clinical severity of the disease. Furthermore, 7 severe type I patients possessed large-scale deletions, including SMN1, NAIP, and GTF2H2. We conclude that SMN1 gene conversion, SMN1 subtle mutations, SMN2 copy number, and the extent of deletion in the 5q13 region should all be considered in the genotype-phenotype analysis of SMA.

Molecular analysis of the dystrophin gene in 407 Chinese patients with Duchenne/Becker muscular dystrophy by the combination of multiplex ligation-dependent probe amplification and Sanger sequencing☆☆☆

BACKGROUND Progressive muscular dystrophy is a leading neuromuscular disorder without any effective treatments and a common genetic cause of mortality among teenagers. A challenge exists in the screening of subtle mutations in 79 exons and little is known about the genotype-phenotype correlation. METHODS Here we adopted multiplex ligation-dependent probe amplification and Sanger sequencing to detect the dystrophin gene in 407 patients and 76 mothers. RESULTS Sixty-three percent (257/407) of the patients harbored a deletion or duplication mutation, with a de novo mutation frequency of 39.5% in 76 affected patients, and approximately 43.7% of the deletions occurred from exon 45 to 52. To those patients suspected with single exon deletion, combined with Sanger sequencing, five subtle mutations were identified: c.8608C>T, c.2302C>T, c.7148dupT, c.10855C>T and c.2071-2093del AGGGAACAGATCCTGGTAAAGCA; the last three mutations were novel. Furthermore, after genotype-phenotype analysis, the severity of DMD/BMD was associated with the frame shift mutation but not with the deletion, the duplication or the number of deleted exons. CONCLUSION The majority of patients have a deletion/duplication mutation in the dystrophin gene, with a hot deletion mutation region from exon 45 to 52. Combined with Sanger sequencing, multiplex ligation-dependent probe amplification is capable of detecting part of subtle mutations.

New Insights into Genotype-phenotype Correlations in Chinese Facioscapulohumeral Muscular Dystrophy: A Retrospective Analysis of 178 Patients

Background: Facioscapulohumeral muscular dystrophy (FSHD), a common autosomal dominant muscular disorder, is caused by contraction of the D4Z4 repeats on 4q35. The complicated genotype-phenotype correlation among different ethnic population remains a controversial subject. We aimed to refine this correlation in order to provide new information for genetic counseling. Methods: Here, a cohort of 136 Chinese families including 178 affected individuals and 137 unaffected members were investigated. Genetic analyses were performed using the p13E-11, 4qA and 4qB probes after pulsed field gel electrophoresis separation and southern blotting. A 10-grade FSHD clinical severity scale was adopted for clinical assessment. The genotype-phenotype correlation was established by linear regression analyses. Results: We observed a roughly inversed correlation between the short EcoRI fragment size and age-corrected clinical severity score in 154 symptomatic patients (P < 0.05). Compared to male patients, a significant higher proportion of females in both asymptomatic carriers and severe patients showed larger variation in the size of short EcoRI fragment. A high incidence (19/42, 45.2%) of asymptomatic (or minimally affected) carriers was found in familial members. Conclusions: Although the number of D4Z4 repeats is known as one of the critical influences on genotype-phenotype correlation, a majority of phenotypic spectrum was still incompatible with their heterozygous contraction of the D4Z4 repeat, especial in female cases. Our results suggest that there are multi-factors synergistically modulating the phenotypic expression.

Modification of phenotype by SMN2 copy numbers in two Chinese families with SMN1 deletion in two continuous generations

BACKGROUND As a lethal autosomal recessive hereditary disorder, childhood spinal muscular atrophy (SMA) is caused by mutations of the survival motor neuron 1 (SMN1) gene. Most of the patients died at early stage or were seriously disabled, which accounts partly for the scarcity of two continuous generations with SMA. Increasing evidence indicated that SMN2 copy number was a modifier of SMA, but in majority of sporadic patients, the bias of phenotype judgments may largely reduce the accuracy of genotype-phenotype analysis. METHODS We presented two families with SMN1-deleted individuals in two continuous generations, the father and daughter of family 1 and the mother and daughter of family 2 were determined to be homozygous for the deletion of the SMN1 gene. Quantitative analysis of SMN1 and SMN2 was carried out by real-time fluorescence quantitative PCR and multiplex ligation-dependent probe amplification. RESULTS Quantitative analysis showed that the father of family 1 possessed three copies of SMN2, and his daughter had only two SMN2 copies; the slightly affected mother of family 2 had three copies of SMN2, but her sick daughter had only two copies of SMN2; we also performed prenatal prediction for family 1 and a healthy boy was born under our suggestion. CONCLUSION For the phenotypes of patients from different generations within the same family are obviously different, the results of a genotype-phenotype analysis may be more convincing, which strongly support the hypothesis that SMN2 is an important modifier for SMA, and SMN2 copy number should be considered in the prenatal diagnosis situation.

Clinical and mutational characteristics of Duchenne muscular dystrophy patients based on a comprehensive database in South China.

The development of clinical trials for Duchenne muscular dystrophy (DMD) in China faces many challenges due to limited information about epidemiological data, natural history and clinical management. To provide these detailed data, we developed a comprehensive database based on registered DMD patients from South China and analysed their clinical and mutational characteristics. The database included DMD registrants confirmed by clinical presentation, family history, genetic detection, prognostic outcome, and/or muscle biopsy. Clinical data were collected by a registry form. Mutations of dystrophin were detected by multiplex ligation-dependent probe amplification (MLPA) and Sanger sequencing. Currently, 132 DMD patients from 128 families in South China have been registered, and 91.7% of them were below 10 years old. In mutational detection, large deletions were the most frequent type (57.8%), followed by small deletion/insertion mutations (14.1%), nonsense mutations (13.3%), large duplications (10.9%), and splice site mutations (3.1%). Clinical analysis revealed that most patients reported initial symptoms between 1 and 3 years of age, but the diagnostic age was more frequently between 6 and 8 years. 81.4% of patients were ambulatory. Baseline cardiac assessments at diagnosis were conducted in 39.4% and 29.5% of patients by echocardiograms and electrocardiograms, respectively. Only 22.7% of registrants performed baseline respiratory assessments. A small numbers of patients (20.5%) were treated with glucocorticoids. 13.3% of patients were eligible for stop codon read-through therapy, and 48.4% of patients would potentially benefit from exon skipping. The top five exon skips applicable to the largest group of registrants were skipping of exons 51 (14.8% of total mutations), 53 (12.5%), 45 (7.0%), 55 (4.7%), and 44 (3.9%). In conclusion, our database provided information on the natural history, diagnosis and management status of DMD in South China, as well as potential molecular therapies suitable for these patients. This comprehensive database will promote future experimental therapies in China.

A Historical Cohort Study on the Efficacy of Glucocorticoids and Riboflavin Among Patients with Late-onset Multiple Acyl-CoA Dehydrogenase Deficiency

Background:Late-onset multiple acyl-CoA dehydrogenase deficiency (MADD) is the most common type of lipid storage myopathies in China. Most patients with late-onset MADD are well responsive to riboflavin. Up to now, these patients are often treated with glucocorticoids as the first-line drug because they are misdiagnosed as polymyositis without muscle biopsy or gene analysis. Although glucocorticoids seem to improve the fatty acid metabolism of late-onset MADD, the objective evaluation of their rationalization on this disorder and comparison with riboflavin treatment are unknown. Methods:We performed a historical cohort study on the efficacy of the two drugs among 45 patients with late-onset MADD, who were divided into glucocorticoids group and riboflavin group. Detailed clinical information of baseline and 1-month follow-up were collected. Results:After 1-month treatment, a dramatic improvement of muscle strength was found in riboflavin group (P < 0.05). There was no significant difference in muscle enzymes between the two groups. Significantly, the number of patients with full recovery in glucocorticoids group was less than the number in riboflavin group (P < 0.05). On the other hand, almost half of the patients in riboflavin group still presented high-level muscle enzymes and weak muscle strength after 1-month riboflavin treatment, meaning that 1-month treatment duration maybe insufficient and patients should keep on riboflavin supplement for a longer time. Conclusions:Our results provide credible evidences that the overall efficacy of riboflavin is superior to glucocorticoids, and a longer duration of riboflavin treatment is necessary for patients with late-onset MADD.

Skeletal Muscle Magnetic Resonance Imaging of the Lower Limbs in Late-onset Lipid Storage Myopathy with Electron Transfer Flavoprotein Dehydrogenase Gene Mutations

Background:Lipid storage myopathy (LSM) is a genetically heterogeneous group with variable clinical phenotypes. Late-onset multiple acyl-coenzyme A dehydrogenation deficiency (MADD) is a rather common form of LSM in China. Diagnosis and clinical management of it remain challenging, especially without robust muscle biopsy result and genetic detection. As the noninvasion and convenience, muscle magnetic resonance imaging (MRI) is a helpful assistant, diagnostic tool for neuromuscular disorders. However, the disease-specific MRI patterns of muscle involved and its diagnostic value in late-onset MADD have not been systematic analyzed. Methods:We assessed the MRI pattern and fat infiltration degree of the lower limb muscles in 28 late-onset MADD patients, combined with detailed clinical features and gene spectrum. Fat infiltration degree of the thigh muscle was scored while that of gluteus was described as obvious or not. Associated muscular atrophy was defined as obvious muscle bulk reduction. Results:The mean scores were significantly different among the anterior, medial, and posterior thigh muscle groups. The mean of fat infiltration scores on posterior thigh muscle group was significantly higher than either anterior or medial thigh muscle group (P < 0.001). Moreover, the mean score on medial thigh muscle group was significantly higher than that of anterior thigh muscle group (P < 0.01). About half of the patients displayed fat infiltration and atrophy in gluteus muscles. Of 28 patients, 12 exhibited atrophy in medial and/or posterior thigh muscle groups, especially in posterior thigh muscle group. Muscle edema pattern was not found in all the patients. Conclusions:Late-onset MADD patients show a typical muscular imaging pattern of fat infiltration and atrophy on anterior, posterior, and medial thigh muscle groups, with major involvement of posterior thigh muscle group and gluteus muscles and a sparing involvement of anterior thigh compartment. Our findings also suggest that muscle MRI of lower limbs is a helpful tool in guiding clinical evaluation on late-onset MADD.

Variations of IGHMBP2 Gene Was Not the Major Cause of Han Chinese Patients With Non-5q-Spinal Muscular Atrophies

Spinal muscular atrophy with respiratory distress type 1 (SMARD1), a notably common form of non-5q-spinal muscular atrophy, can be confused with infantile spinal muscular atrophy and is characterized by the early onset of diaphragmatic palsy and predominantly distal muscle weakness. The defective gene, immunoglobulin mu-binding protein 2 (IGHMBP2), is located on chromosome 11q13-q21. In this study, we screened the IGHMBP2 gene in 53 unrelated Han Chinese non-5q-spinal muscular atrophy patients and 100 healthy controls. Two novel mutations (c.711+1G>C and c.1817G>A) and 5 nucleotide polymorphisms (c.57T>C, c.1554C>T, c.1914G>A, c.2080C>T, and c.2270G>C) were identified. However, only 1 patient harbored the compound heterozygous mutations (c.711+1G>C, c.1817G>A). Furthermore, the homozygous c.2636C>A (p.T879 K) variation, which has been included as a mutation in the Human Gene Mutation Database, was found both in patients and healthy individuals. In conclusion, the IGHMBP2 gene was not found to be a major causative gene linked to Han Chinese non-5q-spinal muscular atrophy patients.

Noninvasive urine-derived cell lines derived from neurological genetic patients.

Many major inherited neurological disorders are characterized by early childhood onset, high lethality rate, and the absence of effective treatments. A poor understanding of the underlying mechanisms of such disorders is partly because of the scarcity of patient-specific samples. In this study, we cultured the urine sediments of such patients, aiming to explore the capacity of urine cell cultures to obtain specimens from patients suffering from rare inherited neurological diseases. We collected fresh urine from a variety of neurogenetic patients; cultured the specimens; generated different urine cell lines; and classified these cell lines through morphology, reverse transcription-PCR, and immunofluorescence. We then used these cell lines to detect the affected genes in spinal muscular atrophy and Duchenne muscular dystrophy. We successfully established cell lines from patients with spinal muscular atrophy, Duchenne muscular dystrophy, paroxysmal kinesigenic dyskinesia, and Wilson’s disease. All established cell lines consisted of urinary tract epithelial cells and podocytes, and had the same gene defects as the blood specimens. Urine cell culture is thus a new, simple, and noninvasive avenue for getting patient-specific samples not only for genetic diagnosis, but also for storing the samples from patients with rare neurological inherited diseases.

Limb-girdle muscular dystrophy type 2I: two Chinese families and a review in Asian patients

ABSTRACT Background: Limb-girdle muscular dystrophy type 2I (LGMD2I) is an autosomal recessive hereditary disorder caused by mutations in the fukutin-related protein (FKRP) gene. Although the features of the disorder in European patients have been summarized, Asian patients with LGMD2I have rarely been reported. Thus, the clinical differences in LGMD2I between Asian and European patients and the associated genetic changes remain unclear. Methods: We reported detailed clinical data as well as results from muscle biopsy, muscle MRI and genetic analysis of the FKRP gene in two unrelated Chinese families with LGMD2I. Additionally, a review of the literature focusing on the clinical and mutational features of LGMD2I in Asian patients was performed. Results: The muscle biopsy results showed dystrophic features. Immunohistochemical staining revealed decreased glycosylations on α-dystroglycan. The muscle MRI results showed that the gluteus maximus, adductor, biceps femoris, vastus intermedius and vastus lateralis were severely affected. The patients in the two families harbored the same compound heterozygous mutations (c.545A>G and c.948delC). One patient showed significant clinical improvement after corticosteroid treatment. Conclusion: Our study expanded the reported spectrum of Asian LGMD2I patients. Our literature review revealed that pathogenic mutations in the FKRP gene in Asian LGMD2I patients are compound heterozygous rather than homozygous. Compound heterozygous Asian patients have a mild phenotype but frequently show respiratory and cardiac impairments. Corticosteroids may be beneficial for the treatment of LGMD2I and should be further investigated.