Shen-Xing Murong

Exome sequencing identifies truncating mutations in PRRT2 that cause paroxysmal kinesigenic dyskinesia.

Paroxysmal kinesigenic dyskinesia is the most common type of paroxysmal movement disorder and is often misdiagnosed clinically as epilepsy. Using whole-exome sequencing followed by Sanger sequencing, we identified three truncating mutations within PRRT2 (NM_145239.2) in eight Han Chinese families with histories of paroxysmal kinesigenic dyskinesia: c.514_517delTCTG (p.Ser172Argfs*3) in one family, c.649dupC (p.Arg217Profs*8) in six families and c.972delA (p.Val325Serfs*12) in one family. These truncating mutations co-segregated exactly with the disease in these families and were not observed in 1,000 control subjects of matched ancestry. PRRT2 is a newly discovered gene consisting of four exons encoding the proline-rich transmembrane protein 2, which encompasses 340 amino acids and contains two predicted transmembrane domains. PRRT2 is highly expressed in the developing nervous system, and a truncating mutation alters the subcellular localization of the PRRT2 protein. The function of PRRT2 and its role in paroxysmal kinesigenic dyskinesia should be further investigated.

A novel mutation in the senataxin gene identified in a Chinese patient with sporadic amyotrophic lateral sclerosis

Our objective was to investigate the association between senataxin mutations and sporadic amyotrophic lateral sclerosis (ALS) in Chinese patients. DNA from 45 sporadic ALS patients was screened for mutations in senataxin using polymerase chain reaction (PCR) and direct sequencing. A novel variation, Thr1118Ile, was identified in a 42-year-old individual with sporadic ALS. This variation was not detected in 200 unrelated control individuals. In conclusion, the presence of this variation in a patient with sporadic ALS, and its absence in 200 controls, supports an association between senataxin and sporadic ALS. This study has broadened the mutation spectrum of senataxin and expanded the clinical phenotypes of senataxin mutations.

Molecular analysis of 51 unrelated pedigrees with late-onset multiple acyl-CoA dehydrogenation deficiency (MADD) in southern China confirmed the most common ETFDH mutation and high carrier frequency of c.250G>A

Multiple acyl-CoA dehydrogenation deficiency (MADD) is an autosomal recessive disease affecting amino acid, fatty acid, and choline metabolisms and is a common genetic defect responsible for lipid storage myopathy. Most forms of MADD are caused by a deficiency of electron transfer flavoprotein (ETF) or ETF dehydrogenase (ETFDH). However, its molecular feature has not been found uniformly in previous reports of Chinese patients. A large cohort of 56 late-onset MADD patients from 51 unrelated pedigrees in southern China was recruited to investigate a clear correlation between clinical phenotype and molecular genetic basis. All exons of ETFA, ETFB, and ETFDH, including the intron–exon boundaries, and 5′ and 3′ untranslated regions were directly sequenced. ETFDH deficiencies affected 94.1% (48/51) of the pedigrees. ETFDH-c.250G>A is the most common mutation, representing a high allelic frequency of 83.3% (80/96). Carrier frequency of c.250G>A is estimated to be 1.35% (7/520) in the normal population. A significant reduced expression of ETFDH was identified in the muscle of ETFDH-deficient patients. ETFDH deficiency is a major cause of riboflavin-responsive MADD in southern China, and c.250G>A is an important mutation that could be employed as a fast and reliable screening method.

Novel SLC20A2 mutations identified in southern Chinese patients with idiopathic basal ganglia calcification.

Idiopathic basal ganglia calcification (IBGC) is a rare neuropsychiatric disorder characterized by bilateral and symmetric cerebral calcifications. Recently, SLC20A2 was identified as a causative gene for familial IBGC, and three mutations were reported in a northern Chinese population. Here, we aimed to explore the mutation spectrum of SLC20A2 in a southern Chinese population. Sanger sequencing was employed to screen mutations within SLC20A2 in two IBGC families and 14 sporadic IBGC cases from a southern Han Chinese population. Four novel mutations (c.82G>A p.D28N, c.185T>C p.L62P, c.1470_1478delGCAGGTCCT p.Q491_L493del and c.935-1G>A) were identified in two families and two sporadic cases, respectively; none were detected in 200 unrelated controls. No mutation was found in the remaining 12 patients. Different mutations may result in varied phenotypes, including brain calcification and clinical manifestations. Our study supports the hypothesis that SLC20A2 is a causative gene of IBGC and expands the mutation spectrum of SLC20A2, which facilitates the understanding of the genotype-phenotype correlation of IBGC.

Molecular analysis of SMN1, SMN2, NAIP, GTF2H2, and H4F5 genes in 157 Chinese patients with spinal muscular atrophy.

Spinal muscular atrophy (SMA) is a common and lethal autosomal recessive neurodegenerative disorder, which is caused by mutations of the survival motor neuron 1 (SMN1) gene. Additionally, the phenotype is modified by several genes nearby SMN1 in the 5q13 region. In this study, we analyzed mutations in SMN1 and quantified the modifying genes, including SMN2, NAIP, GTF2H2, and H4F5 by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP), multiplex ligation-dependent probe amplification (MLPA), TA cloning, allele-specific long-range PCR, and Sanger sequencing in 157 SMA patients. Most SMA patients (94.90%) possessed a homozygous SMN1 deletion, while 10 patients demonstrated only the absence of exon 7, but the presence of exon 8. Two missense mutations (c.689 C>T and c.844 C>T) were identified in 2 patients who both carried a single copy of SMN1. We found inverse correlations between SMN2, the NAIP copy number, and the clinical severity of the disease. Furthermore, 7 severe type I patients possessed large-scale deletions, including SMN1, NAIP, and GTF2H2. We conclude that SMN1 gene conversion, SMN1 subtle mutations, SMN2 copy number, and the extent of deletion in the 5q13 region should all be considered in the genotype-phenotype analysis of SMA.

Molecular analyses of GCH-1, TH and parkin genes in Chinese dopa-responsive dystonia families

The symptomatic treatment of dopa‐responsive dystonia (DRD) emphasizes the importance of molecular analyses of the GCH‐1, TH and parkin genes. However, these analyses have not been extensively studied in Chinese DRD patients. Ten DRD families from the Han ethnic group including 14 patients and 28 clinically unaffected relatives were screened for GCH‐1, TH and parkin mutations by direct sequencing, semiquantitative polymerase chain reaction (PCR), polymerase chain reaction–restriction fragment length polymorphism analysis and allele‐specific PCR. Variations were verified in 200 unrelated control subjects. We have identified six novel mutations and three known mutations. The novel mutations are Leu91Val, Pro95Leu, Val204Gly and 628delC in GCH‐1 gene; Gly216Ser in TH gene; and Cys253Phe in parkin gene. After molecular analyses of seven families with identified GCH‐1 mutations, nine asymptomatic cases were found among 23 relatives, which confirmed the low penetrance of DRD. Unlike previous publications, male patients with GCH‐1 mutations have early onset ages, while some female patients have very late onset ages in this medium‐size series. Our data show that it is difficult to establish an evident genotype–phenotype correlation for DRD. However, it is necessary to know the genetic defects of DRD patients in clinics, which will help elucidate the mode of inheritance, facilitate causal therapy with levodopa and evaluate the prognosis.

FSHD in Chinese population: Characteristics of translocation and genotype-phenotype correlation

Current studies of facioscapulohumeral muscular dystrophy (FSHD) are confined to the white population. The authors surveyed 110 healthy individuals and 27 families with FSHD including 55 patients and 74 relatives by pulsed-field gel electrophoresis. The authors report the characteristics of translocation and genotype-phenotype correlation, and their results indicate 4q to 10q translocation contributes to the occurrence of de novo mutation. This leads to a more severe phenotype in the Chinese population comparing to EcoRI allele sizes and the intersexual difference.

Molecular analysis of the dystrophin gene in 407 Chinese patients with Duchenne/Becker muscular dystrophy by the combination of multiplex ligation-dependent probe amplification and Sanger sequencing☆☆☆

BACKGROUND Progressive muscular dystrophy is a leading neuromuscular disorder without any effective treatments and a common genetic cause of mortality among teenagers. A challenge exists in the screening of subtle mutations in 79 exons and little is known about the genotype-phenotype correlation. METHODS Here we adopted multiplex ligation-dependent probe amplification and Sanger sequencing to detect the dystrophin gene in 407 patients and 76 mothers. RESULTS Sixty-three percent (257/407) of the patients harbored a deletion or duplication mutation, with a de novo mutation frequency of 39.5% in 76 affected patients, and approximately 43.7% of the deletions occurred from exon 45 to 52. To those patients suspected with single exon deletion, combined with Sanger sequencing, five subtle mutations were identified: c.8608C>T, c.2302C>T, c.7148dupT, c.10855C>T and c.2071-2093del AGGGAACAGATCCTGGTAAAGCA; the last three mutations were novel. Furthermore, after genotype-phenotype analysis, the severity of DMD/BMD was associated with the frame shift mutation but not with the deletion, the duplication or the number of deleted exons. CONCLUSION The majority of patients have a deletion/duplication mutation in the dystrophin gene, with a hot deletion mutation region from exon 45 to 52. Combined with Sanger sequencing, multiplex ligation-dependent probe amplification is capable of detecting part of subtle mutations.

New Insights into Genotype-phenotype Correlations in Chinese Facioscapulohumeral Muscular Dystrophy: A Retrospective Analysis of 178 Patients

Background: Facioscapulohumeral muscular dystrophy (FSHD), a common autosomal dominant muscular disorder, is caused by contraction of the D4Z4 repeats on 4q35. The complicated genotype-phenotype correlation among different ethnic population remains a controversial subject. We aimed to refine this correlation in order to provide new information for genetic counseling. Methods: Here, a cohort of 136 Chinese families including 178 affected individuals and 137 unaffected members were investigated. Genetic analyses were performed using the p13E-11, 4qA and 4qB probes after pulsed field gel electrophoresis separation and southern blotting. A 10-grade FSHD clinical severity scale was adopted for clinical assessment. The genotype-phenotype correlation was established by linear regression analyses. Results: We observed a roughly inversed correlation between the short EcoRI fragment size and age-corrected clinical severity score in 154 symptomatic patients (P < 0.05). Compared to male patients, a significant higher proportion of females in both asymptomatic carriers and severe patients showed larger variation in the size of short EcoRI fragment. A high incidence (19/42, 45.2%) of asymptomatic (or minimally affected) carriers was found in familial members. Conclusions: Although the number of D4Z4 repeats is known as one of the critical influences on genotype-phenotype correlation, a majority of phenotypic spectrum was still incompatible with their heterozygous contraction of the D4Z4 repeat, especial in female cases. Our results suggest that there are multi-factors synergistically modulating the phenotypic expression.

Chinese patients with Machado‐Joseph disease presenting with complicated hereditary spastic paraplegia

Background and purpose:  The clinical overlap between Machado‐Joseph disease (MJD) and autosomal dominant complicated hereditary spastic paraplegia (AD‐HSP) is extensive and the differentiation between them can be difficult on clinical ground. However, patients are seeking the right diagnosis and it is important for neurologists to distinguish them in the early stage.