Wan-Jin Chen

Exome sequencing identifies truncating mutations in PRRT2 that cause paroxysmal kinesigenic dyskinesia.

Paroxysmal kinesigenic dyskinesia is the most common type of paroxysmal movement disorder and is often misdiagnosed clinically as epilepsy. Using whole-exome sequencing followed by Sanger sequencing, we identified three truncating mutations within PRRT2 (NM_145239.2) in eight Han Chinese families with histories of paroxysmal kinesigenic dyskinesia: c.514_517delTCTG (p.Ser172Argfs*3) in one family, c.649dupC (p.Arg217Profs*8) in six families and c.972delA (p.Val325Serfs*12) in one family. These truncating mutations co-segregated exactly with the disease in these families and were not observed in 1,000 control subjects of matched ancestry. PRRT2 is a newly discovered gene consisting of four exons encoding the proline-rich transmembrane protein 2, which encompasses 340 amino acids and contains two predicted transmembrane domains. PRRT2 is highly expressed in the developing nervous system, and a truncating mutation alters the subcellular localization of the PRRT2 protein. The function of PRRT2 and its role in paroxysmal kinesigenic dyskinesia should be further investigated.

Novel SLC20A2 mutations identified in southern Chinese patients with idiopathic basal ganglia calcification.

Idiopathic basal ganglia calcification (IBGC) is a rare neuropsychiatric disorder characterized by bilateral and symmetric cerebral calcifications. Recently, SLC20A2 was identified as a causative gene for familial IBGC, and three mutations were reported in a northern Chinese population. Here, we aimed to explore the mutation spectrum of SLC20A2 in a southern Chinese population. Sanger sequencing was employed to screen mutations within SLC20A2 in two IBGC families and 14 sporadic IBGC cases from a southern Han Chinese population. Four novel mutations (c.82G>A p.D28N, c.185T>C p.L62P, c.1470_1478delGCAGGTCCT p.Q491_L493del and c.935-1G>A) were identified in two families and two sporadic cases, respectively; none were detected in 200 unrelated controls. No mutation was found in the remaining 12 patients. Different mutations may result in varied phenotypes, including brain calcification and clinical manifestations. Our study supports the hypothesis that SLC20A2 is a causative gene of IBGC and expands the mutation spectrum of SLC20A2, which facilitates the understanding of the genotype-phenotype correlation of IBGC.

Molecular analysis of SMN1, SMN2, NAIP, GTF2H2, and H4F5 genes in 157 Chinese patients with spinal muscular atrophy.

Spinal muscular atrophy (SMA) is a common and lethal autosomal recessive neurodegenerative disorder, which is caused by mutations of the survival motor neuron 1 (SMN1) gene. Additionally, the phenotype is modified by several genes nearby SMN1 in the 5q13 region. In this study, we analyzed mutations in SMN1 and quantified the modifying genes, including SMN2, NAIP, GTF2H2, and H4F5 by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP), multiplex ligation-dependent probe amplification (MLPA), TA cloning, allele-specific long-range PCR, and Sanger sequencing in 157 SMA patients. Most SMA patients (94.90%) possessed a homozygous SMN1 deletion, while 10 patients demonstrated only the absence of exon 7, but the presence of exon 8. Two missense mutations (c.689 C>T and c.844 C>T) were identified in 2 patients who both carried a single copy of SMN1. We found inverse correlations between SMN2, the NAIP copy number, and the clinical severity of the disease. Furthermore, 7 severe type I patients possessed large-scale deletions, including SMN1, NAIP, and GTF2H2. We conclude that SMN1 gene conversion, SMN1 subtle mutations, SMN2 copy number, and the extent of deletion in the 5q13 region should all be considered in the genotype-phenotype analysis of SMA.

Molecular analysis of the dystrophin gene in 407 Chinese patients with Duchenne/Becker muscular dystrophy by the combination of multiplex ligation-dependent probe amplification and Sanger sequencing☆☆☆

BACKGROUND Progressive muscular dystrophy is a leading neuromuscular disorder without any effective treatments and a common genetic cause of mortality among teenagers. A challenge exists in the screening of subtle mutations in 79 exons and little is known about the genotype-phenotype correlation. METHODS Here we adopted multiplex ligation-dependent probe amplification and Sanger sequencing to detect the dystrophin gene in 407 patients and 76 mothers. RESULTS Sixty-three percent (257/407) of the patients harbored a deletion or duplication mutation, with a de novo mutation frequency of 39.5% in 76 affected patients, and approximately 43.7% of the deletions occurred from exon 45 to 52. To those patients suspected with single exon deletion, combined with Sanger sequencing, five subtle mutations were identified: c.8608C>T, c.2302C>T, c.7148dupT, c.10855C>T and c.2071-2093del AGGGAACAGATCCTGGTAAAGCA; the last three mutations were novel. Furthermore, after genotype-phenotype analysis, the severity of DMD/BMD was associated with the frame shift mutation but not with the deletion, the duplication or the number of deleted exons. CONCLUSION The majority of patients have a deletion/duplication mutation in the dystrophin gene, with a hot deletion mutation region from exon 45 to 52. Combined with Sanger sequencing, multiplex ligation-dependent probe amplification is capable of detecting part of subtle mutations.

Clinical and genetic spectra in a series of Chinese patients with Charcot–Marie–Tooth disease

The aim of this study was to determine the clinical features and frequencies of genetic subtypes in a series of patients with Charcot-Marie-Tooth (CMT) disease from Eastern China. Patients were divided into three subtypes, CMT1, CMT2 and hereditary neuropathy with liability to pressure palsy (HNPP), according to their electrophysiological manifestations. Multiplex ligation-dependent probe analysis (MLPA) was performed to detect duplications/deletions in the PMP22 gene. The coding regions and splice sites of the GJB1, MPZ, MFN2 and GDAP-1 genes were determined by direct sequencing. Among the 148 patients in the study, 37.2% of the cases had mutations in genes assessed. The mutation detection rate was higher in patients with family histories than in spontaneous cases. PMP22 duplication (13.5%) was predominant in this group of patients, followed by PMP22 deletion (11.5%), and point mutations in GJB1 (8.8%), MPZ (2.0%) and MFN2 (0.7%). Three novel mutations (c.151T>C and c.310 A>G in GJB1 and c.1516 C>G in MFN2) were detected. A small deletion in PMP22 exon 4 was detected in a patient with severe CMT1. Genetic tests have great value in CMT patients with family histories. The frequency of PMP22 duplications was lower in Asian patients than in others. We suggest that genetic testing strategies in CMT patients should be primarily based on electromyography data.

Modeling the phenotype of spinal muscular atrophy by the direct conversion of human fibroblasts to motor neurons

Spinal muscular atrophy (SMA) is a lethal autosomal recessive neurological disease characterized by selective degeneration of motor neurons in the spinal cord. In recent years, the development of cellular reprogramming technology has provided an alternative and effective method for obtaining patient-specific neurons in vitro. In the present study, we applied this technology to the field of SMA to acquire patient-specific induced motor neurons that were directly converted from fibroblasts via the forced expression of 8 defined transcription factors. The infected fibroblasts began to grow in a dipolar manner, and the nuclei gradually enlarged. Typical Tuj1-positive neurons were generated at day 23. After day 35, induced neurons with multiple neurites were observed, and these neurons also expressed the hallmarks of Tuj1, HB9, ISL1 and CHAT. The conversion efficiencies were approximately 5.8% and 5.5% in the SMA and control groups, respectively. Additionally, the SMA-induced neurons exhibited a significantly reduced neurite outgrowth rate compared with the control neurons. After day 60, the SMA-induced neurons also exhibited a liability of neuronal degeneration and remarkable fracturing of the neurites was observed. By directly reprogramming fibroblasts, we established a feeder-free conversion system to acquire SMA patient-specific induced motor neurons that partially modeled the phenotype of SMA in vitro.

Mitochondrial DNA Haplogroups and the Risk of Sporadic Parkinson's Disease in Han Chinese

Background: Mitochondrial dysfunction is linked to the pathogenesis of Parkinsons disease (PD). However, the precise role of mitochondrial DNA (mtDNA) variations is obscure. On the other hand, mtDNA haplogroups have been inconsistently reported to modify the risk of PD among different population. Here, we try to explore the relationship between mtDNA haplogroups and sporadic PD in a Han Chinese population. Methods: Nine single-nucleotide polymorphisms, which define the major Asian mtDNA haplogroups (A, B, C, D, F, G), were detected via polymerase chain reaction-restriction fragment length polymorphism or denaturing polyacrylamide gel electrophoresis in 279 sporadic PD patients and 510 matched controls of Han population. Results: Overall, the distribution of mtDNA haplogroups did not show any significant differences between patients and controls. However, after stratification by age at onset, the frequency of haplogroup B was significantly lower in patients with early-onset PD (EOPD) compared to the controls (odds ratio [OR] =0.225, 95% confidence interval [CI]: 0.082–0.619, P = 0.004), while other haplogroups did not show significant differences. After stratification by age at examination, among subjects younger than 50 years of age: Haplogroup B also showed a lower frequency in PD cases (OR = 0.146, 95% CI: 0.030–0.715, P = 0.018) while haplogroup D presented a higher risk of PD (OR = 3.579, 95% CI: 1.112–11.523, P = 0.033), other haplogroups also did not show significant differences in the group. Conclusions: Our study indicates that haplogroup B might confer a lower risk for EOPD and people younger than 50 years in Han Chinese, while haplogroup D probably lead a higher risk of PD in people younger than 50 years of age. In brief, particular Asian mtDNA haplogroups likely play a role in the pathogenesis of PD among Han Chinese.

Modification of phenotype by SMN2 copy numbers in two Chinese families with SMN1 deletion in two continuous generations

BACKGROUND As a lethal autosomal recessive hereditary disorder, childhood spinal muscular atrophy (SMA) is caused by mutations of the survival motor neuron 1 (SMN1) gene. Most of the patients died at early stage or were seriously disabled, which accounts partly for the scarcity of two continuous generations with SMA. Increasing evidence indicated that SMN2 copy number was a modifier of SMA, but in majority of sporadic patients, the bias of phenotype judgments may largely reduce the accuracy of genotype-phenotype analysis. METHODS We presented two families with SMN1-deleted individuals in two continuous generations, the father and daughter of family 1 and the mother and daughter of family 2 were determined to be homozygous for the deletion of the SMN1 gene. Quantitative analysis of SMN1 and SMN2 was carried out by real-time fluorescence quantitative PCR and multiplex ligation-dependent probe amplification. RESULTS Quantitative analysis showed that the father of family 1 possessed three copies of SMN2, and his daughter had only two SMN2 copies; the slightly affected mother of family 2 had three copies of SMN2, but her sick daughter had only two copies of SMN2; we also performed prenatal prediction for family 1 and a healthy boy was born under our suggestion. CONCLUSION For the phenotypes of patients from different generations within the same family are obviously different, the results of a genotype-phenotype analysis may be more convincing, which strongly support the hypothesis that SMN2 is an important modifier for SMA, and SMN2 copy number should be considered in the prenatal diagnosis situation.

Clinical and mutational characteristics of Duchenne muscular dystrophy patients based on a comprehensive database in South China.

The development of clinical trials for Duchenne muscular dystrophy (DMD) in China faces many challenges due to limited information about epidemiological data, natural history and clinical management. To provide these detailed data, we developed a comprehensive database based on registered DMD patients from South China and analysed their clinical and mutational characteristics. The database included DMD registrants confirmed by clinical presentation, family history, genetic detection, prognostic outcome, and/or muscle biopsy. Clinical data were collected by a registry form. Mutations of dystrophin were detected by multiplex ligation-dependent probe amplification (MLPA) and Sanger sequencing. Currently, 132 DMD patients from 128 families in South China have been registered, and 91.7% of them were below 10 years old. In mutational detection, large deletions were the most frequent type (57.8%), followed by small deletion/insertion mutations (14.1%), nonsense mutations (13.3%), large duplications (10.9%), and splice site mutations (3.1%). Clinical analysis revealed that most patients reported initial symptoms between 1 and 3 years of age, but the diagnostic age was more frequently between 6 and 8 years. 81.4% of patients were ambulatory. Baseline cardiac assessments at diagnosis were conducted in 39.4% and 29.5% of patients by echocardiograms and electrocardiograms, respectively. Only 22.7% of registrants performed baseline respiratory assessments. A small numbers of patients (20.5%) were treated with glucocorticoids. 13.3% of patients were eligible for stop codon read-through therapy, and 48.4% of patients would potentially benefit from exon skipping. The top five exon skips applicable to the largest group of registrants were skipping of exons 51 (14.8% of total mutations), 53 (12.5%), 45 (7.0%), 55 (4.7%), and 44 (3.9%). In conclusion, our database provided information on the natural history, diagnosis and management status of DMD in South China, as well as potential molecular therapies suitable for these patients. This comprehensive database will promote future experimental therapies in China.

Novel mutations of PDGFRB cause primary familial brain calcification in Chinese families

Four causative genes, including solute carrier family 20 member 2 (SLC20A2), platelet-derived growth factor receptor b (PDGFRB), platelet-derived growth factor b (PDGFB)and xenotropic and polytropic retrovirus receptor 1 (XPR1), have been identified to cause primary familial brain calcification (PFBC). However, PDGFRB mutations seem to be quite rare and no PDGFRB mutations have been reported in Chinese PFBC patients. A total of 146 PFBC patients including 12 families and 134 sporadic patients were recruited in this study. All of them were previously tested negative for the SLC20A2. Mutational analyses of the entire exons and exon–intron boundaries of PDGFRB were carried out by direct gene sequencing. In silico analyses of the identified variants were conducted using Mutation Taster, PolyPhen-2 and Sorts Intolerant From Tolerant. Two heterozygous variants, c.3G>A and c.2209G>A, of the PDGFRB gene were revealed in two PFBC families, respectively. These two variants were not observed in 200 healthy controls. The variant c.3G>A was located in exon 2 and affected the initiation codon of the PDGFRB gene. The variant c.2209G>A resulted in amino-acid substitutions of aspartic acid to asparagine at position 737. Both of these two variants co-segregated with the disease phenotype (variant carriers in Family 1: I1, II2 and II3; variant carriers in Family 2: I2 and II8), suggesting a pathogenic impact of these variants. The prevalence of PDGFRB mutations in Chinese PFBC patients seems to be quite low, indicating that PDGFRB is not a major causative gene of PFBC in Chinese population.