Octavio Peralta

Spectrum of BRCA1/2 point mutations and genomic rearrangements in high-risk breast/ovarian cancer Chilean families

The distribution of BRCA1/2 germline mutations in breast/ovarian cancer (BC/OC) families varies among different populations. In the Chilean population, there are only two reports of mutation analysis of BRCA1/2, and these included a low number of BC and/or OC patients. Moreover, the prevalence of BRCA1/2 genomic rearrangements in Chilean and in other South American populations is unknown. In this article, we present the mutation-detection data corresponding to a set of 326 high-risk families analyzed by conformation-sensitive gel electrophoresis and heteroduplex analysis. To determine the contribution of BRCA1/2 LGRs in Chilean BC patients, we analyzed 56 high-risk subjects with no pathogenic BRCA1/2 point mutations. Germline BRCA1/2 point mutations were found in 23 (7.1%) of the 326 Chilean families. Families which had at least three BC and/or OC cases showed the highest frequency of mutations (15.9%). We identified 14 point pathogenic mutations. Three recurrent mutations in BRCA1 (c.187_188delAG, c.2605_2606delTT, and c.3450_3453delCAAG) and three in BRCA2 (c.4969_4970insTG, c.5374_5377delTATG, and c.6503_6504delTT) contributed to 63.6 and 66.7% of all the deleterious mutations of each gene, which may reflect the presence of region-specific founder effects. Taken together BRCA1/2 recurrent point mutations account for 65.2% (15/23) of the BRCA1/2 (+) families. No large deletions or duplications involving BRCA1/2 were identified in a subgroup of 56 index cases negative for BRCA1/2 point mutations. Our study, which is the largest conducted to date in a South American population, provides a comprehensive analysis on the type and distribution of BRCA1/2 mutations and allelic variants.

Absence of CHEK2 1100delC mutation in familial breast cancer cases from a South American population

The most widely accepted model proposes that familial breast cancer susceptibility is a consequence of a small number of mutations in BRCA1 or BRCA2 (BRCA1/2) and a much higher proportion of mutations in ethnic-specific genes of moderate and/or low penetrance [1]. CHEK2 gene, involved in DNA damage and replication checkpoints, has been pointed out as a good candidate. Moreover, a specific variant in this gene, 1100delC, has been found to increase breast cancer susceptibility among familial breast cancer cases not attributable to mutations in BRCA1/2 [2]. Most of the studies evaluating this mutation as a female breast cancer susceptibility allele have been conducted in European populations, where the prevalence of the variant in controls ranged from 0 out of 400 controls in Spain to 2.8% in the Netherlands (Table 1). This variant has been detected in a considerable higher proportion (4–11%) in patients with a positive family history of breast cancer (usually known to be BRCA1/2 mutation-negative) from Northern Europe (Table 1) This variant has been estimated to be associated with an approximately 1.5–2.0 fold increased risk in female breast cancer cases with a positive family history [4–6]. CHEK2 has not been well studied in other ethnic groups. In our laboratory, we evaluated the 1100delC mutation in 3 Chilean groups: (a) 196 breast cancer patients belonging to high risk Chilean families of which 184 were BRCA1/2 negatives [21]; (b) a control group of 500 healthy Chilean females with no personal or familial history of breast or other cancer. Cases and controls were matched by age and ethnic background; (c) the third group included 624 healthy Chilean females but with at least two relatives in first or second degree with breast cancer. This study was approved by the Institutional Review Board of the School of Medicine of the University of Chile. Informed consent was obtained from all the participants. No other mutations in the CHEK2 gene have been studied because it seems that the 1100delC is the only CHEK2 allele that makes an appreciable contribution to breast cancer susceptibility [22]. Genomic DNA extracted from blood was genotyped for CHEK2 1100delC by restriction fragment length polymorphisms (RFLP). PCR was carried out using oligonucleotides 50 CTTTTGCACTGAATTTTAGAGTA 30 and 50 ACCTCCTACCAGTCTGTGC 30, which specifically amplify exon 10 from the functional copy of CHEK2 on chromosome 22, relative to the non-functional pseudogenes [16]. The PCR product was digested with RsaI Grant support: FONDECYT 1060094, CONAC.

Association of PALB2 sequence variants with the risk of familial and early-onset breast cancer in a South-American population

BackgroundGermline mutations in PALB2 have been identified in approximately 1% of familial breast cancer (BC) in several populations. Nevertheless its contribution in the South-American population is unknown. The goal of this study was to determine the prevalence of PALB2 mutations in the Chilean population.Methods100 Chilean BRCA1/2-negatives familial BC cases were included for the PALB2 mutation analysis. We use conformational sensitive gel electrophoresis and direct sequencing. Using a case-control design, we studied the identified variants in 436 BC cases and 809 controls to evaluate their possible association with BC risk.ResultsNo pathogenic mutations were detected. We identified three variants, the variant c.1861C > A not previously described was found in one of the 436 cases and none of the 809 controls. The bioinformatic analyses indicate that this variant probably is not pathogenic. PALB2 c.1676A > G (rs152451A/G) and c.2993C > T (rs45551636C/T) variants were significantly associated with increased BC risk only in cases with a strong family history of BC (OR = 1.9 [CI 95% 1.3-2.8] p < 0.01 and OR = 3.3 [CI 95% 1.4-7.3] p < 0.01, respectively). The rs152451A/G-rs45551636C/T composite genotype produce increase of the BC risk in cases with a strong family history of BC (OR = 3.6 [CI 95% 1.7-8.0] p = 0.003). The rs152451-G/rs45551636-C and rs152451-G/rs45551636-T haplotypes were associated with an increased BC risk only in cases with a strong family history of BC (OR = 1.6 [CI 95% 1.0-2.5] p = 0.05 and OR = 3.7 [CI 95% 1.8-7.5] p < 0.001, respectively).ConclusionOur results suggest that PALB2 c.1676A > G and c.2993C > T play roles in BC risk in women with a strong family history of BC.