Patricio Gonzalez-Hormazabal

Spectrum of BRCA1/2 point mutations and genomic rearrangements in high-risk breast/ovarian cancer Chilean families

The distribution of BRCA1/2 germline mutations in breast/ovarian cancer (BC/OC) families varies among different populations. In the Chilean population, there are only two reports of mutation analysis of BRCA1/2, and these included a low number of BC and/or OC patients. Moreover, the prevalence of BRCA1/2 genomic rearrangements in Chilean and in other South American populations is unknown. In this article, we present the mutation-detection data corresponding to a set of 326 high-risk families analyzed by conformation-sensitive gel electrophoresis and heteroduplex analysis. To determine the contribution of BRCA1/2 LGRs in Chilean BC patients, we analyzed 56 high-risk subjects with no pathogenic BRCA1/2 point mutations. Germline BRCA1/2 point mutations were found in 23 (7.1%) of the 326 Chilean families. Families which had at least three BC and/or OC cases showed the highest frequency of mutations (15.9%). We identified 14 point pathogenic mutations. Three recurrent mutations in BRCA1 (c.187_188delAG, c.2605_2606delTT, and c.3450_3453delCAAG) and three in BRCA2 (c.4969_4970insTG, c.5374_5377delTATG, and c.6503_6504delTT) contributed to 63.6 and 66.7% of all the deleterious mutations of each gene, which may reflect the presence of region-specific founder effects. Taken together BRCA1/2 recurrent point mutations account for 65.2% (15/23) of the BRCA1/2 (+) families. No large deletions or duplications involving BRCA1/2 were identified in a subgroup of 56 index cases negative for BRCA1/2 point mutations. Our study, which is the largest conducted to date in a South American population, provides a comprehensive analysis on the type and distribution of BRCA1/2 mutations and allelic variants.

Absence of CHEK2 1100delC mutation in familial breast cancer cases from a South American population

The most widely accepted model proposes that familial breast cancer susceptibility is a consequence of a small number of mutations in BRCA1 or BRCA2 (BRCA1/2) and a much higher proportion of mutations in ethnic-specific genes of moderate and/or low penetrance [1]. CHEK2 gene, involved in DNA damage and replication checkpoints, has been pointed out as a good candidate. Moreover, a specific variant in this gene, 1100delC, has been found to increase breast cancer susceptibility among familial breast cancer cases not attributable to mutations in BRCA1/2 [2]. Most of the studies evaluating this mutation as a female breast cancer susceptibility allele have been conducted in European populations, where the prevalence of the variant in controls ranged from 0 out of 400 controls in Spain to 2.8% in the Netherlands (Table 1). This variant has been detected in a considerable higher proportion (4–11%) in patients with a positive family history of breast cancer (usually known to be BRCA1/2 mutation-negative) from Northern Europe (Table 1) This variant has been estimated to be associated with an approximately 1.5–2.0 fold increased risk in female breast cancer cases with a positive family history [4–6]. CHEK2 has not been well studied in other ethnic groups. In our laboratory, we evaluated the 1100delC mutation in 3 Chilean groups: (a) 196 breast cancer patients belonging to high risk Chilean families of which 184 were BRCA1/2 negatives [21]; (b) a control group of 500 healthy Chilean females with no personal or familial history of breast or other cancer. Cases and controls were matched by age and ethnic background; (c) the third group included 624 healthy Chilean females but with at least two relatives in first or second degree with breast cancer. This study was approved by the Institutional Review Board of the School of Medicine of the University of Chile. Informed consent was obtained from all the participants. No other mutations in the CHEK2 gene have been studied because it seems that the 1100delC is the only CHEK2 allele that makes an appreciable contribution to breast cancer susceptibility [22]. Genomic DNA extracted from blood was genotyped for CHEK2 1100delC by restriction fragment length polymorphisms (RFLP). PCR was carried out using oligonucleotides 50 CTTTTGCACTGAATTTTAGAGTA 30 and 50 ACCTCCTACCAGTCTGTGC 30, which specifically amplify exon 10 from the functional copy of CHEK2 on chromosome 22, relative to the non-functional pseudogenes [16]. The PCR product was digested with RsaI Grant support: FONDECYT 1060094, CONAC.

MICE TESTICULAR DAMAGE ELICITED BY MALATHION

Los pesticidas organofosforados son un problema de salud mundial, especialmente para los trabajadores agricolas, calculados en alrededor de 2.600 millones de personas en el ano 2001. Se conoce muy poco sobre el dano reproductivo en el varon provocado por estos agentes. El efecto agudo de Malathion en inyeccion intraperitoneal unica, de 1/12 la LD50 en raton fue analizado 1,8,16,35 y 40 dias despues de la inyeccion, evaluando proliferacion y apoptosis de las celulas espermatogenicas y dano de las celulas de Sertoli, estudiados por la deteccion inmunocitoquimica de citoqueratina (usando CK-18). Los resultados muestran disminucion del numero de celulas germinales, seguida de una proliferacion compensatoria de espermatogonias al dia 16 (como lo muestra la incorporacion de timidina H3 al testiculo), aumento de la tasa de apoptosis (especialmente de espermatogonias y espermatocitos en preleptoteno), la reactividad a CK-18 de las celulas de Sertoli que denota alteracion de ellas, probablemente asociada a dano de la linea germinal que se observa en los animales tratados a intervalos cortos. El malathion es genotoxico para las celulas somaticas como lo demuestra el test de micronucleo. En consecuencia, se postula que junto al proceso de espermatogenesis, son afectadas las celulas de Sertoli y de Leydig. La recuperacion morfologica del testiculo se observa solo a intervalos largos

Toward an objective measure of functional disability in dysferlinopathy.

Understanding the natural history of dysferlinopathy is essential to design and quantify novel therapeutic protocols. Our aim in this study was to assess, clinically and functionally, a cohort of patients with dysferlinopathy, using validated scales.

Association of PALB2 sequence variants with the risk of familial and early-onset breast cancer in a South-American population

BackgroundGermline mutations in PALB2 have been identified in approximately 1% of familial breast cancer (BC) in several populations. Nevertheless its contribution in the South-American population is unknown. The goal of this study was to determine the prevalence of PALB2 mutations in the Chilean population.Methods100 Chilean BRCA1/2-negatives familial BC cases were included for the PALB2 mutation analysis. We use conformational sensitive gel electrophoresis and direct sequencing. Using a case-control design, we studied the identified variants in 436 BC cases and 809 controls to evaluate their possible association with BC risk.ResultsNo pathogenic mutations were detected. We identified three variants, the variant c.1861C > A not previously described was found in one of the 436 cases and none of the 809 controls. The bioinformatic analyses indicate that this variant probably is not pathogenic. PALB2 c.1676A > G (rs152451A/G) and c.2993C > T (rs45551636C/T) variants were significantly associated with increased BC risk only in cases with a strong family history of BC (OR = 1.9 [CI 95% 1.3-2.8] p < 0.01 and OR = 3.3 [CI 95% 1.4-7.3] p < 0.01, respectively). The rs152451A/G-rs45551636C/T composite genotype produce increase of the BC risk in cases with a strong family history of BC (OR = 3.6 [CI 95% 1.7-8.0] p = 0.003). The rs152451-G/rs45551636-C and rs152451-G/rs45551636-T haplotypes were associated with an increased BC risk only in cases with a strong family history of BC (OR = 1.6 [CI 95% 1.0-2.5] p = 0.05 and OR = 3.7 [CI 95% 1.8-7.5] p < 0.001, respectively).ConclusionOur results suggest that PALB2 c.1676A > G and c.2993C > T play roles in BC risk in women with a strong family history of BC.

Genetic Variants in pre-miR-146a, pre-miR-499, pre-miR-125a, pre-miR-605, and pri-miR-182 Are Associated with Breast Cancer Susceptibility in a South American Population

Breast cancer (BC) is one of the most frequent tumors affecting women worldwide. microRNAs (miRNAs) single-nucleotide polymorphisms (SNPs) likely contribute to BC susceptibility. We evaluated the association of five SNPs with BC risk in non-carriers of the BRCA1/2-mutation from a South American population. The SNPs were genotyped in 440 Chilean BRCA1/2-negative BC cases and 1048 controls. Our data do not support an association between rs2910164:G>C or rs3746444:A>G and BC risk. The rs12975333:G>T is monomorphic in the Chilean population. The pre-miR-605 rs2043556-C allele was associated with a decreased risk of BC, both in patients with a strong family history of BC and in early-onset non-familial BC (Odds ratio (OR) = 0.5 [95% confidence interval (CI) 0.4–0.9] p = 0.006 and OR = 0.6 [95% CI 0.5–0.9] p = 0.02, respectively). The rs4541843-T allele is associated with increased risk of familial BC. This is the first association study on rs4541843 and BC risk. Previously, we showed that the TOX3-rs3803662:C>T was significantly associated with increased risk of familial BC. Given that TOX3 mRNA is a target of miR-182, and that both the TOX3 rs3803662-T and pri-miR-182 rs4541843-T alleles are associated with increased BC risk, we evaluated their combined effect. Risk of familial BC increased in a dose-dependent manner with the number of risk alleles (p-trend = 0.0005), indicating an additive effect.

Prevalence of clarithromycin resistance in Helicobacter pylori in Santiago, Chile, estimated by real-time PCR directly from gastric mucosa

BackgroundCurrent available treatments for Helicobacter pylori eradication are chosen according to local clarithromycin and metronidazole resistance prevalence. The aim of this study was to estimate, by means of molecular methods, both clarithromycin and metronidazole resistance in gastric mucosa from patients infected with H.pylori.MethodsA total of 191 DNA samples were analyzed. DNA was purified from gastric mucosa obtained from patients who underwent an upper gastrointestinal endoscopy at an university hospital from Santiago, Chile, between 2011 and 2014. H.pylori was detected by real-time PCR. A 5’exonuclease assay was developed to detect A2142G and A2143G mutations among H.pylori-positive samples. rdxA gene was sequenced in samples harboring A2142G and A2143G mutations in order to detect mutations that potentially confer dual clarithromycin and metronidazole resistance.ResultsNinety-three (93) out of 191 DNA samples obtained from gastric mucosa were H.pylori-positive (48.7%). Clarithromycin-resistance was detected in 29 samples (31.2% [95%CI 22.0–41.6%]). The sequencing of rdxA gene revealed that two samples harbored truncating mutations in rdxA, one sample had an in-frame deletion, and 11 had amino acid changes that likely cause metronidazole resistance.ConclusionsWe estimated a prevalence of clarithomycin-resistance of 31.8% in Santiago, Chile. Three of them harbor inactivating mutations in rdxA and 11 had missense mutations likely conferring metronidazole resistance. Our results require further confirmation. Nevertheless, they are significant as an initial approximation in re-evaluating the guidelines for H.pylori eradication currently used in Chile.

IL-8-251T>A (rs4073) Polymorphism Is Associated with Prognosis in Gastric Cancer Patients

Background/Aim: Inflammation is a key process in gastric carcinogenesis. Cytokines are mediators of inflammation and are involved in metastasis and tumorigenicity. We previously assessed the role of cytokine gene polymorphisms in gastric cancer risk in Chile. In the present study, we aimed to analyze whether these polymorphisms are associated with overall survival (OS) in gastric cancer (GC) patients. Patients and Methods: A total of 153 individuals with GC diagnosis were followed-up for at least 2 years. Hazard ratios (HR) were estimated from Cox regression models using SNPs as predictor variables. The following SNPs were genotyped for study using a TaqMan assay: rs16944 (IL1B -511C>T); rs4073 (IL8 -251 T>A); rs2275913 (IL-17 -197G>A); rs1800872 (IL10 -592 C>A); rs1800896 (IL10 -1082A>G); rs28372698 (IL32). Results: Interleukin-8 rs4073 (IL-8 -251T>A) showed association with OS under the dominant model (TA + AA) only when adjusted by clinicopathological variables (HR=1.64, 95%CI=1.05-2.55, p=0.030, q-value=0.18), but not with the univariate model (HR=1.51, 95%CI=0.98-2.31, p=0.062, q-value=0.37). No significant differences were observed after adjusting for population stratification (PC1 and PC2 from Principal Component Analysis using genotypes from Infinium Global Screening Array). After stratification by clinicopathological variables, the association with shorter overall survival was higher among patients with diffuse-type tumors (HR=2.24, 95%CI=1.16-4.45) and patients with tumor size >5 cm (HR=1.79, 95%CI=1.08-2.97). Conclusion: These results suggest a role of IL-8 rs4073 in cancer prognosis. Its use as a prognostic marker of GC survival warrants further investigation.

Polymorphisms inTWIST1andZEB1Are Associated with Prognosis of Gastric Cancer Patients

Background/Aim: Epithelial–mesenchymal transition (EMT) program has been linked as a driver of metastatic dissemination by conferring migratory and invasive capacity to cancer cells. Gastric cancer (GC) patients with tumors expressing altered levels of EMT markers have low survival. This study aimed to assess if polymorphisms of CDH1, TWIST1, SNAIL2, ZEB1 and ZEB2 genes are associated with survival in GC patients. Patients and Methods: A total of 153 individuals with diagnosis of GC were recruited in Santiago, Chile. All patients were genotyped using Infinium Global Screening Array (GSA). Twenty Tag SNPs of the studied genes were retrieved. Results: Three SNPs were associated with survival: rs2526614 (TWIST1) (genotype CA + AA, adjusted HR=0.58, 95%CI=0.37-0.93), rs6953766 (TWIST1) (genotype GG, crude HR=2.02, 95%CI=1.06-3.82, adjusted HR=2.14, 95%CI=1.07-4.25), and rs431073 (ZEB1) (genotype AC + CC, crude HR=1.62, 95%CI=1.01-2.59, adjusted HR=1.96, 95%CI=1.18-3.25). Conclusion: To the best of our knowledge, this is the first study proposing a role of these SNPs in cancer prognosis. Their use as prognostic markers of GC survival warrants further investigation.

Prevalence of dual clarithromycin and metronidazole resistance in Helicobacter pylori estimated by molecular methods in Santiago, Chile

Background Current available treatments for Helicobacter pylori eradication are chosen according to local clarithromycin and metronidazole resistance prevalence. The aim of this study was to estimate, by means of molecular methods, both clarithromycin and metronidazole resistance in gastric mucosa from patients infected with H.pylori. Methods A total of 191 DNA samples were analyzed. DNA was purified from gastric mucosa obtained from patients who underwent an upper gastrointestinal endoscopy at an university hospital from Santiago, Chile, between 2011 and 2014. H.pylori was detected by real-time PCR. A 5’exonuclease assay was developed to detect A2142G and A2143G mutations among Hpylori-positive samples. rdxA gene was sequenced in samples harboring A2142G and A2143G mutations in order to detect mutations that potentially confer dual clarithromycin and metronidazole resistance. Results Ninety-three (93) out of 191 DNA samples obtained from gastric mucosa were H. pylori-positive (48.7%). Clarithromycin-resistance was detected in 29 samples (31.2% [95%CI 22.0%-41.6%]). The sequencing of rdxA gene revealed that two samples harbored truncating mutations in rdxA, one sample had an in-frame deletion, and 11 had amino acid changes that likely cause metronidazole resistance. Conclusions We estimated a prevalence of clarithomycin-resistance of 31.8% in Santiago, Chile. The proportion of dual clarithromycin and metronidazole resistance could be, at least, 15.0%. Our results require further confirmation. Nevertheless, they are significant as an initial approximation in re-evaluating the guidelines for H.pylori eradication currently used in Chile.