Ratana Lawung

Bioactive metabolites from Spilanthes acmella Murr.

Spilanthes acmella Murr. (Compositae) has been used as a traditional medicine for toothache, rheumatism and fever. Its extracts had been shown to exhibit vasorelaxant and antioxidant activities. Herein, its antimicrobial, antioxidant and cytotoxic activities were evaluated. Agar dilution method assays against 27 strains of microorganisms were performed. Results showed that fractions from the chloroform and methanol extracts inhibited the growth of many tested organisms, e.g. Corynebacterium diphtheriae NCTC 10356 with minimum inhibitory concentration (MIC) of 64-256 μg/mL and Bacillus subtilis ATCC 6633 with MIC of 128-256 μg/mL. The tested fractions all exhibited antioxidant properties in both DPPH and SOD assays. Potent radical scavenging activity was observed in the DPPH assay. No cytotoxic effects of the extracts against KB and HuCCA-1 cell lines were evident. Bioassay-guided isolation resulted in a diverse group of bioactive compounds such as phenolics [vanillic acid (2), trans-ferulic acid (5) and trans-isoferulic acid (6)], coumarin (scopoletin, 4) and triterpenoids like 3-acetylaleuritolic acid (1), β-sitostenone (3), stigmasterol and stigmasteryl-3-O-β-D-glucopyranosides, in addition to a mixture of stigmasteryl-and β-sitosteryl-3-O-β-D-glucopyranosides. The compounds 1–6 represent bioactive metabolites of S. acmella Murr. that were never previously reported. Our findings demonstrate for the first time the potential benefits of this medicinal plant as a rich source of high therapeutic value compounds for medicines, cosmetics, supplements and as a health food.

Activities of thiotetrahydropyridines as antioxidant and antimicrobial agents

Tetrahydropyridines have been reported previously as important medicinal agents. The present study, thiotetrahydropyridines were prepared and tested for antioxidants (DPPH and SOD assays) and antimicrobials (agar dilution method). The results show that 1-acetyl-1,2,3,4and 1,2,3,6-thiotetrahydropyridines 15a-b, 16, 17 and 18a are new antioxidants that scavenge superoxide and free radicals. Whereas the analogs 15a and 16 are novel antimicrobials. Significantly, 1-acetyl-2-(1-adamantylthio)-3,4-diacetoxy-1,2,3,4-tetrahydropyridine (15a) is the most potent compound that inhibits the growth of Streptococcus pyogenes and Moraxella catarrhalis with MIC of 32 μg/mL, of Corynebacterium diphtheriae NCTC 10356 and of Vibrio cholerae (MIC of 64 μg/mL). Remarkably, the analog 15a is the most potent antioxidant and antimicrobial agent. This finding reveals a new and unique group of 1-acetyl-1,2,3,4thiotetrahydropyridines as interesting lead compound with potential to be further developed for medicinal applications.

Reference map and comparative proteomic analysis of Neisseria gonorrhoeae displaying high resistance against spectinomycin.

A proteome reference map of Neisseria gonorrhoeae was successfully established using two-dimensional gel electrophoresis in conjunction with matrix-assisted laser desorption ionization-time of flight mass spectrometry. This map was further applied to compare protein expression profiles of high-level spectinomycin-resistant (clinical isolate) and -susceptible (reference strain) N. gonorrhoeae following treatment with subminimal inhibitory concentrations (subMICs) of spectinomycin. Approximately 200 protein spots were visualized by Coomassie brilliant blue G-250 staining and 66 spots representing 58 unique proteins were subsequently identified. Most of the identified proteins were analysed as cytoplasmic proteins and belonged to the class of energy metabolism. Comparative proteomic analysis of whole protein expression of susceptible and resistant gonococci showed up to 96% similarity while eight proteins were found to be differentially expressed in the resistant strain. In the presence of subMICs of spectinomycin, it was found that 50S ribosomal protein L7/L12, an essential component for ribosomal translocation, was upregulated in both strains, ranging from 1.5- to 3.5-fold, suggesting compensatory mechanisms of N. gonorrhoeae in response to antibiotic that inhibits protein synthesis. Moreover, the differential expression of proteins involved in energy metabolism, amino acid biosynthesis, and the cell envelope was noticeably detected, indicating significant cellular responses and adaptation against antibiotic stress. Such knowledge provides valuable data, not only fundamental proteomic data, but also knowledge of the mode of action of antibiotic and secondary target proteins implicated in adaptation and compensatory mechanisms.

One-step PCR for the identification of multiple antimicrobial resistance in Neisseria gonorrhoeae

One-step multiplex PCR was developed for the identification of gonococci and antimicrobial-resistant profiles. From forty Neisseria gonorrhoeae isolates, the penicillinase-producing N. gonorrhoeae (PPNG), the high-level tetracycline-resistant N. gonorrhoeae (TRNG), and the ciprofloxacin-resistant N. gonorrhoeae (CRNG) were successfully classified. Our method provides expediency and benefit to epidemiology and antimicrobial-resistance mobility with 100% sensitivity and specificity for gonococcal-detection. The detection limit was 500 CFU/reaction.

Antimicrobial resistance markers as a monitoring index of gonorrhoea in Thailand

Multiplex PCR was applied to explore the antimicrobial-resistance profiles of 145 gonococci isolated from Bangrak Hospital, Thailand in 2007. All isolates were clearly identified for the plasmid-mediated resistant types of penicillin (Asia, Africa and Toronto) and tetracycline (American and Dutch). This method can also predict the decreased susceptibility to ciprofloxacin by detection of Ser-91 mutation. Prevalence rates of penicillinase-producing Neisseria gonorrhoeae (PPNG) and high-level tetracycline-resistance N. gonorrhoeae (TRNG) were shown to be high as 82.1% and 84.1%, respectively. Most PPNG carried the Africa-type (78.2%) while the American-type (61.8%) was harboured in most TRNG. Mono- and triple-resistance patterns were presented in 2.6% and 79.5% of male, 20.7% and 62.1% of men who have sex with men (MSM), 0% and 75.0% of female, and 10% and 70% of female sex workers (FSW). Additionally, the rate of the Dutch type was high in patients among the age of 35-44 years (57.1%) and female patients (43.8%). The changing types of plasmids have been noticed during the time period of study. The multi-resistance patterns of the gonococcal isolates can be used as an epidemiological index of gonorrhoea and human sexual behaviours. This information will support the management of individual patients as well as the public health surveillance.

Antibiograms and randomly amplified polymorphic DNA-polymerase chain reactions (RAPD-PCR) as epidemiological markers of gonorrhea

The development of antimicrobial resistance of Neisseria gonorrhoeae arising from wide dissemination of resistant clones is a major global health problem. In this study, a total of 235 isolates of N. gonorrhoeae isolated from patients of Bangrak Hospital were tested for their antibiotic susceptibilities to penicillin, norfloxacin, ofloxacin, ciprofloxacin, spectinomycin, and ceftriaxone. Mutation (Ser‐91) in the quinolone resistance determining regions of gyrA and random amplification of the polymorphic DNA polymerase chain reaction (RAPD‐PCR) were examined from 145 isolates. Among these, 55 isolates were obtained during January–March 2000, 46 isolates during January–March 2002, and 44 isolates during October–December 2002. The occurrence of combination resistance between penicillin and quinolone was 20% in January–March 2000, which was increased to 57.8% during the period of October–December 2002 (P<0.0001). Mutation of Ser‐91 in gyrA could be directly linked with the resistance or declining of susceptibility to ciprofloxacin. Using RAPD‐PCR, we could classify the 145 isolates into 4 and 5 groups by primers D11344 (5′‐AGTGAATTCGCGGTGAGATGCCA‐3′) and D8635 (5′‐GAGCGGCCAAAGGGAGCA GAC‐3′), respectively. Combination of the data obtained from these two primers produced 11 fingerprint groups. Our findings conclude that monitoring of the Ser‐91 mutation of gyrA and RAPD‐PCR methods are most useful for epidemiological screening. J. Clin. Lab. Anal. 24:31–37, 2010.

Increasing trend of multiple resistance and genomic mobility of Neisseria gonorrhoeae to penicillin and quinolone

A significant decline of gonorrhea incidence has been observed during the years 1990-99. However, a slight increase in the number of cases has been reported in 2000. In addition, an increase in resistant strains has been found in Thailand. In this study, 207 isolates of N. gonorrhoeae from patients attending Bangrak hospital (National Centre of Sexually Transmitted Infections), 67 isolates obtained during January-March 2000, 74 isolates obtained during January-March 2002, and 66 isolates obtained during October-December 2002, were tested. All isolates were susceptible to ceftriaxone while 71.5% and 74.4% were resistant to penicillin and quinolone, respectively. The high level of ciprofloxacin resistance (MIC ≥4 mg/L) also increased from 13.4% during January-March 2000 to 25.8% during OctoberDecember 2002. Multiple resistance determinants commonly coexisted in a single isolate so that the level of resistance was increased. The incidence of double resistance determinants, penicillin and quinolone resistance, were significantly increased from 34.3% among isolates during January to March 2000 up to 77.3% among isolates during October to December 2002 (P 1.024 g/L). Several plasmid patterns have been identified and various patterns of the plasmid can be artificially transferred and maintained their expression in Escherichia coli transformants. Such evidences infer the high mobility of resistant genome among microorganisms in the region. Moreover, the significant increase in penicillin and quinolone resistance herein, indicates the selective pressure and the diversity of genomic distribution among N. gonorrhoeae in Thailand. Primers JDA (5’-TAC TCA ATC GGT AAT TGG CTT C-3’) and JDB (5’-CCA TAT CAC CGT CGG TAC TG-3’) have been designed from sequences of the Asia, the Africa, and the Toronto β-lactamase plasmids. By using the JDA and the JDB as PCR primers, our data reveal the highest prevalence and a significantly increasing trend of the epidemic Africa type of genomic β−lactamase.

Retinol-binding protein 4 and its potential roles in hypercholesterolemia revealed by proteomics.

Effects of hypercholesterolemia on alterations of serum proteins have not been fully elucidated. Herein, using two-dimensional gel electrophoresis (2-DE) in conjunction with LC-MS searching has successfully been carried out to investigate the change of protein expression profiles as consequences of raised blood cholesterol at different levels (normal group: total cholesterol 200 mg/dL; borderline high group: total cholesterol 200-239 mg/dL; and high group: total cholesterol ≥ 240 mg/dL) (n = 45). Results revealed that down-regulation of retinol-binding protein 4 (RBP4) (-2.26 fold), transthyretin (-1.25 fold) and gelsolin (-1.47 fold) was observed in the high group. Meanwhile, the other proteins such as haptoglobin, complement factor B and CD5 antigen-like protein were up-regulated upto +3.24, +1.96 and +2.04 fold, respectively. Confirmation by Western blotting revealed a significant reduction of RBP4 (approximately 50 %) in individual samples derived from the high group. Presumptive conclusion can be drawn that down-regulation of RBP4 might be attributable to the inflammation of adipocytes caused by the release of proinflammatory cytokines (e.g. tumor necrosis factor α and interleukin-1β) from adipose tissues. Moreover, the decrease of transthyretin might also be taken into accounts since it is known that the transthyretin usually forms complex with RBP4 to prevent glomerular filtration and excretion through the kidney. The suppressing effect on RBP4 should be potentiated by the increase of complement factor B and CD5 antigen-like protein, which rendered the adipose tissues to overwhelm the liberation of RBP4 to blood circulation by metabolic and inflammatory processes. Such inflammation could further modulate the induction of cytokine release (e.g. IL-6 and IL-1β), resulting in the synthesis of acute phase protein, in particular, haptoglobin and C-reactive proteins from hepatocytes. However, the mechanism of gelsolin reduction remains unclear. Among these differentially expressed proteins, the RBP4 has been proposed as a major linkage between hypercholesterolemia, adipose tissues, liver and kidney, which is believed to be a potential biomarker for metabolic and cardiovascular disorders associated with dyslipidemia in the future.

Revelation of staphylococcal cassette chromosome mec types in methicillin-resistant Staphylococcus aureus isolates from Thailand and Vietnam

Methicillin resistant Staphylococcus aureus (MRSA) is highly prevalent, and its typing plays a crucial role in epidemiology and evolution in both health and community settings. Multiplex PCR and staphylococcal cassette chromosome mec (SCCmec) typing based on mec complexes and cassette chromosome recombinase (ccr) allotypes have been developed for MRSA identification. The first of these procedures can identify 4 mec classes (A, B, C1, and E) and 2 ccr allotypes (B2 and B4) in one tube, and the second can identify mecA, mec class C2, and 3 allotypes (A1, A3, and C). Our method offers a novel means to further differentiate between the main SCCmec types I through XI and is both highly sensitive (detectable up to 0.3ηg DNA) and specific (100%). Several SCCmec types (I, III, IV, V and a non-typeable group) were found in 66 MRSA isolates obtained from Ho Chi Minh City, Vietnam and Nakhon Pathom, Thailand. SCCmec type III was highly predominant in both regions. The designed assay is rapid, convenient, flexible, and reliable. Therefore, this assay is suitable for the high-throughput screening of the main SCCmec types of MRSA isolates.

Protocol for a Facile Multiplex PCR for Multi-antimicrobial Resistance and Gonococcus Detection

Gonorrhea is a continuing problem worldwide particularly in terms of the spread of multiple drug resistance. We have successfully developed an efficient PCR method for the simultaneous identification of gonococci and detection of the antimicrobial-resistant profile. By this method, penicillinase-producing Neisseria gonorrhoeae (PPNG), high-level tetracycline-resistant N. gonorrhoeae (TRNG), and ciprofloxacin-resistant N. gonorrhoeae (CRNG) can be clearly identified. Moreover, the plasmid-types of penicillin and tetracycline resistance are also characterized. The method has 100 % sensitivity and specificity. It is also time- and labor-saving compared to the conventional method. Thus, the procedure is suitable for epidemiological surveillance.