Rungrot Cherdtrakulkiat

New bioactive triterpenoids and antimalarial activity of Diospyros rubra Lec.

The first investigation of the chemical constituents and bioactivities of Diospyros rubra Lec. is reported. D. rubra extracts were screened for antimicrobial, antimalarial and cytotoxic activities. They were only shown to be active antimalarials. The extracts with good antimalarial activity were isolated and extensively purified to give lupeol (1), lupenone (2), betulin (3), lupeol acetate (4), 28-O-acetylbetulin (5), β-sitosteryl-3-O-β-D-glucopyranoside (6) and a mixture of β-sitosterol and stigmasterol. Some of the isolates were tested for antimicrobial and cytotoxic actions. Betulin (3) displayed antimicrobial activity against Streptococcus pyogenes with a minimum inhibitory concentration (MIC) of 85 μg/mL. Interestingly, bioactive fractions all selectively exerted some antimicrobial activity against Corynebacterium diphtheriae NCTC 10356 with the MIC range of 64-256 μg/mL. The study provides data to support the medicinal importance of the D. rubra.

Derivatives (halogen, nitro and amino) of 8-hydroxyquinoline with highly potent antimicrobial and antioxidant activities

8-Hydroxyquinoline (8HQ) compounds have been reported to possess diverse bioactivities. In recent years, drug repositioning has gained considerable attention in drug discovery and development. Herein, 8HQ (1) and its derivatives (2–9) bearing various substituents (amino, nitro, cyano and halogen) were investigated for their antimicrobial against 27 microorganisms (agar dilution method) and antioxidant (DPPH method) activities. The parent 8HQ (1) exerted a highly potent antimicrobial activity against Gram-positive bacteria including diploid fungi and yeast with MIC values in the range of 3.44–13.78 μM. Moreover, the halogenated 8HQ, especially 7-bromo-8HQ (4) and clioquinol (6), displayed a high antigrowth activity against Gram-negative bacteria compared with the parent compound (1). Apparently, the derivatives with a relatively high safely index, e.g., nitroxoline (2), exhibited strong antibacterial activity against Aeromonas hydrophila (MIC=5.26 μM) and selectively inhibited the growth of P. aeruginosa with the MIC value of 84.14 μM; cloxyquin (3) showed a strong activity against Listseria monocytogenes and Plesiomonas shigelloides with MIC values of 5.57 and 11.14 μM, respectively. Most compounds displayed an antioxidant activity. Specifically, 5-amino-8HQ (8) was shown to be the most potent antioxidant (IC50=8.70 μM) compared with the positive control (α-tocopherol) with IC50 of 13.47 μM. The findings reveal that 8HQ derivatives are potential candidates to be further developed as antimicrobial and antioxidant agents.

One-step PCR for the identification of multiple antimicrobial resistance in Neisseria gonorrhoeae

One-step multiplex PCR was developed for the identification of gonococci and antimicrobial-resistant profiles. From forty Neisseria gonorrhoeae isolates, the penicillinase-producing N. gonorrhoeae (PPNG), the high-level tetracycline-resistant N. gonorrhoeae (TRNG), and the ciprofloxacin-resistant N. gonorrhoeae (CRNG) were successfully classified. Our method provides expediency and benefit to epidemiology and antimicrobial-resistance mobility with 100% sensitivity and specificity for gonococcal-detection. The detection limit was 500 CFU/reaction.

Bioactive triterpenoids, antimicrobial, antioxidant and cytotoxic activities of Eclipta prostrata Linn

Rungrot Cherdtrakulkiat, Somchai Boonpangrak, Ratchanok Pingaew, Supaluk Prachayasittikul, Somsak Ruchirawat, Virapong Prachayasittikul* Department of Clinical Microbiology and Applied Technology, Faculty of Medical Technology, Mahidol University, Bangkok 10700, Thailand. Center for Innovation Development and Technology Transfer, Faculty of Medical Technology,Mahidol University, Bangkok 10700, Thailand. Department of Chemistry, Faculty of Science, Srinakharinwirot University, Bangkok 10110, Thailand. Center of Data Mining and Biomedical Informatics, Faculty of Medical Technology, Mahidol University, Bangkok 10700, Thailand. Laboratory of Medicinal Chemistry, Chulabhorn Research Institute and Program in Chemical Biology, Chulabhorn Graduate Institute, Bangkok 10210, Thailand. Center of Excellence on Environmental Health and Toxicology, Commission on Higher Education (CHE), Ministry of Education, Thailand.

Antimicrobial resistance markers as a monitoring index of gonorrhoea in Thailand

Multiplex PCR was applied to explore the antimicrobial-resistance profiles of 145 gonococci isolated from Bangrak Hospital, Thailand in 2007. All isolates were clearly identified for the plasmid-mediated resistant types of penicillin (Asia, Africa and Toronto) and tetracycline (American and Dutch). This method can also predict the decreased susceptibility to ciprofloxacin by detection of Ser-91 mutation. Prevalence rates of penicillinase-producing Neisseria gonorrhoeae (PPNG) and high-level tetracycline-resistance N. gonorrhoeae (TRNG) were shown to be high as 82.1% and 84.1%, respectively. Most PPNG carried the Africa-type (78.2%) while the American-type (61.8%) was harboured in most TRNG. Mono- and triple-resistance patterns were presented in 2.6% and 79.5% of male, 20.7% and 62.1% of men who have sex with men (MSM), 0% and 75.0% of female, and 10% and 70% of female sex workers (FSW). Additionally, the rate of the Dutch type was high in patients among the age of 35-44 years (57.1%) and female patients (43.8%). The changing types of plasmids have been noticed during the time period of study. The multi-resistance patterns of the gonococcal isolates can be used as an epidemiological index of gonorrhoea and human sexual behaviours. This information will support the management of individual patients as well as the public health surveillance.

Antibiograms and randomly amplified polymorphic DNA-polymerase chain reactions (RAPD-PCR) as epidemiological markers of gonorrhea

The development of antimicrobial resistance of Neisseria gonorrhoeae arising from wide dissemination of resistant clones is a major global health problem. In this study, a total of 235 isolates of N. gonorrhoeae isolated from patients of Bangrak Hospital were tested for their antibiotic susceptibilities to penicillin, norfloxacin, ofloxacin, ciprofloxacin, spectinomycin, and ceftriaxone. Mutation (Ser‐91) in the quinolone resistance determining regions of gyrA and random amplification of the polymorphic DNA polymerase chain reaction (RAPD‐PCR) were examined from 145 isolates. Among these, 55 isolates were obtained during January–March 2000, 46 isolates during January–March 2002, and 44 isolates during October–December 2002. The occurrence of combination resistance between penicillin and quinolone was 20% in January–March 2000, which was increased to 57.8% during the period of October–December 2002 (P<0.0001). Mutation of Ser‐91 in gyrA could be directly linked with the resistance or declining of susceptibility to ciprofloxacin. Using RAPD‐PCR, we could classify the 145 isolates into 4 and 5 groups by primers D11344 (5′‐AGTGAATTCGCGGTGAGATGCCA‐3′) and D8635 (5′‐GAGCGGCCAAAGGGAGCA GAC‐3′), respectively. Combination of the data obtained from these two primers produced 11 fingerprint groups. Our findings conclude that monitoring of the Ser‐91 mutation of gyrA and RAPD‐PCR methods are most useful for epidemiological screening. J. Clin. Lab. Anal. 24:31–37, 2010.

Revelation of staphylococcal cassette chromosome mec types in methicillin-resistant Staphylococcus aureus isolates from Thailand and Vietnam

Methicillin resistant Staphylococcus aureus (MRSA) is highly prevalent, and its typing plays a crucial role in epidemiology and evolution in both health and community settings. Multiplex PCR and staphylococcal cassette chromosome mec (SCCmec) typing based on mec complexes and cassette chromosome recombinase (ccr) allotypes have been developed for MRSA identification. The first of these procedures can identify 4 mec classes (A, B, C1, and E) and 2 ccr allotypes (B2 and B4) in one tube, and the second can identify mecA, mec class C2, and 3 allotypes (A1, A3, and C). Our method offers a novel means to further differentiate between the main SCCmec types I through XI and is both highly sensitive (detectable up to 0.3ηg DNA) and specific (100%). Several SCCmec types (I, III, IV, V and a non-typeable group) were found in 66 MRSA isolates obtained from Ho Chi Minh City, Vietnam and Nakhon Pathom, Thailand. SCCmec type III was highly predominant in both regions. The designed assay is rapid, convenient, flexible, and reliable. Therefore, this assay is suitable for the high-throughput screening of the main SCCmec types of MRSA isolates.

Synthesis, biological evaluation and in silico study of bis-thiourea derivatives as anticancer, antimalarial and antimicrobial agents

Two sets of bis-thioureas including a para series (8–14) and a meta series (4, 5, 15–19), were synthesized and evaluated for their anticancer, antimalarial and antimicrobial activities. Most of the synthesized bis-thioureas, except for analogs 8–11, displayed cytotoxicity against MOLT-3 cell line (IC50 = 1.55–32.32 µM). Derivatives 5, 14, 18 and 19 showed a broad spectrum of anticancer activity. Analogs (4, 5, 8, 13, 14, 18 and 19) exhibited higher inhibitory efficacy in HepG2 cells than the control drug, etoposide. Significantly, bis-trifluoromethyl analog 19 was the promising potent cytotoxic agent (IC50 = 1.50–18.82 µM) with the best safety index (1.64–20.60). Antimalarial activity results showed that trifluoromethyl derivative 18 was the most potent compound (IC50 = 1.92 µM, selective index = 6.86). Antimicrobial activity revealed that bis-thioureas 12, 18 and 19 exhibited selective activity against Gram-positive bacteria and fungi. Promisingly, the bis-trifluoromethyl derivative 19 was the most potent compound in the series and displayed higher potency, against most of the Gram-positive bacteria and fungi, than that of ampicillin, the reference drug. Among the tested strains of microorganisms, compound 19 inhibited the growth of Staphylococcus epidermidis ATCC 12228 and Micrococcus luteus ATCC 10240 with the lowest MIC of 1.47 µM. The findings demonstrated that trifluoromethyl group plays a crucial role in their biological activities. Furthermore, the molecular docking was performed to reveal possible binding modes of the compounds against target proteins.

Protocol for a Facile Multiplex PCR for Multi-antimicrobial Resistance and Gonococcus Detection

Gonorrhea is a continuing problem worldwide particularly in terms of the spread of multiple drug resistance. We have successfully developed an efficient PCR method for the simultaneous identification of gonococci and detection of the antimicrobial-resistant profile. By this method, penicillinase-producing Neisseria gonorrhoeae (PPNG), high-level tetracycline-resistant N. gonorrhoeae (TRNG), and ciprofloxacin-resistant N. gonorrhoeae (CRNG) can be clearly identified. Moreover, the plasmid-types of penicillin and tetracycline resistance are also characterized. The method has 100 % sensitivity and specificity. It is also time- and labor-saving compared to the conventional method. Thus, the procedure is suitable for epidemiological surveillance.

Antimicrobial and cytotoxic acetogenin from Polyalthia debilis

ABSTRACT Objective: To isolate bioactive acetogenin compound and to investigate antimicrobial, antioxidant as well as cytotoxic activities of the isolate, fractions and extracts of Polyalthia debilis. Methods: The P. debilis (roots) extracts and isolated compound were tested for their antimicrobial (agar dilution method) against twenty-seven strains of microorganisms (gram positive and gram negative bacteria, and diploid fungus), antioxidant (DPPH assay) and cytotoxic activities. The plant extracts were isolated by column chromatography and structure of compound was confirmed by spectral data . Result: The plant extracts and isolated fractions exhibited antioxidant and cytotoxic activities. The isolated acetogenin 1 (debilisome E) displayed antimicrobial activity against Morexella catarrhalis with the MIC of 64 microgram/mL, Corynebacterium diphtheriae NCTC 10356 and Streptococcus pyogenes with partial inhibition (50-75%) at 128 microgram/mL. The compound 1 exerted cytotoxic activity against 5 cancer cells (HepG2, A549, HCC-S102,HL-60 and P388) with IC50 values 18.4 - 40.3 microgram/mL. Conclusion: The results demonstrate novel bioactivities of P. debilis as antimicrobials and anticancer agents.