Ricardo Márquez-Velasco

Anti-tumor necrosis factor VNAR single domains reduce lethality and regulate underlying inflammatory response in a murine model of endotoxic shock.

BackgroundIn sepsis, tumor necrosis factor (TNF) is the key factor triggering respiratory burst, tissue injury and disseminated coagulation. Anti-TNF strategies based on monoclonal antibodies or F(ab’)2 fragments have been used in sepsis with contradictory results. Immunoglobulin new antigen receptors (IgNAR) are a unique subset of antibodies consisting of five constant (CNAR) and one variable domains (VNAR). VNAR domains are the smallest, naturally occurring, antibody-based immune recognition units, having potential use as therapy.Our aim was to explore the impact of an anti-TNF VNAR on survival in an experimental model of endotoxic shock. Also, mRNA expression and serum protein of several inflammatory molecules were measured.ResultsEndotoxic shock was induced by lipopolysaccharide (LPS) in male Balb/c mice. Animals were treated with anti-TNF VNAR domains, F(ab’)2 antibody fragments, or saline solution 15 minutes before, 2 h and 24 h after lethal dose100 (LD100) LPS administration. TNF blockade with either VNAR domains or F(ab’)2 fragments were associated with lower mortality (60% and 75%, respectively) compared to LD100. Challenge with LPS induced significant production of serum TNF and interleukins -10 and -6 at 3 h. After that, significant reduction of IL-6 at 24 h (vs 3 h) was shown only in the VNAR group. Nitrites level also increased in response to LPS.In liver, TNF and IL-10 mRNA expression showed a pro-inflammatory imbalance in response to LPS. Blocking TNF was associated with a shift towards an anti-inflammatory status; however, polarization was more pronounced in animals receiving F(ab’)2 fragments than in those with VNAR therapy. With regard to IL-6, gene expression was increased at 3 h in all groups. TNF blockade was associated with rapid and sustained suppression of IL-6 expression, even more evident in the VNAR group. Finally, expression of inducible-nitric oxide synthase (iNOS) increased in response to LPS at 3 h, but this was decreased at 24 h only in the anti-TNF VNAR group.ConclusionsAnti-TNF VNAR single domains improved survival in a murine model of endotoxic shock. Protection was associated with regulation in the TNF/IL-10 balance, attenuation of IL-6 and iNOS gene expression in the liver as well as decreased serum IL-6 concentration.

LPS pretreatment by the oral route protects against sepsis induced by cecal ligation and puncture. Regulation of proinflammatory response and IgM anti-LPS antibody production as associated mechanisms

Abstract.Objective:To explore the efficacy of prophylactic oral lipopolysaccharide (LPS) in sepsis induced by cecal ligation and puncture (CLP).Material:Male Balb/c mice. LPS serotype O55: B5Treatment:Mice were treated every 4 days for a total of 5 times with 50 μg of LPS by intraperitoneal (IP) or oral (O) routes. Treatment was stopped one week prior to CLP. Control (C) groups received the vehicle orally, and sham (S) groups were used as reference.Methods:Histopathology was performed to determine inflammation in liver and lung. Serum cytokines were measured by ELISA, and TNFα tissue expression by RTPCR. Antibodies against LPS were measured by ELISA.Results:Administration of LPS by the oral route significantly increased survival (p<0.05) of mice in association with a reduction of Kupffer cells in liver, pulmonary edema in lung, shorter or delayed TNFα expression in target organs, a trend to decreased IFNγ and increased IL-10 serum levels, and a notable increase in the production of specific IgM anti-LPS antibodies.Conclusions:LPS by oral route protected against CLP. The underlying mechanisms could be the modulation of the proinflammatory response and an increased production of IgM anti-LPS antibodies.

Interferon-Gamma Increases the Ratio of Matrix Metalloproteinase-9/Tissue Inhibitor of Metalloproteinase-1 in Peripheral Monocytes from Patients with Coronary Artery Disease

Acute coronary syndromes (ACS) may be triggered by acute infections. Systemic production of interferon gamma (IFN-γ) is induced during infection and regulates the production of matrix metalloproteinases (MMPs) and their inhibitors (TIMPs), both important in plaque stability. This study evaluates the effect of IFN-γ on the MMPs/TIMP-1 ratio in cultured monocytes from 30 patients with stable coronary artery disease (CAD), 30 with unstable angina (UA) or non-ST-segment elevation myocardial infarction (NSTEMI), and 30 healthy blood donors. Supernatant concentrations of MMP-1, -2, -9, and TIMP-1 were measured by enzyme-linked immunoassays. Basal concentration of MMP-1 and TIMP-1 was similar between groups, while MMP-2 was higher in healthy individuals and MMP-9 in patients with UA/NSTEMI. Upon IFN-γ stimulation, MMP-9 secretion increased in all groups, while TIMP-1 decreased only in patients with CAD, which in turn result in a strikingly elevation in their mean MMP-9/TIMP-1 ratio. MMP-1/TIMP-1 and MMP-2/TIMP-1 ratios were <1.0 in basal conditions and after stimulation in all groups. Our results suggest that nonstimulated monocytes from patients with stable CAD show a similar behavior than those from healthy individuals. However, stimulation with IFN-γ induces an increase on the MMP-9/TIMP-1 ratio as high as that found in patients with ACS. Thus, it may bring biological plausibility to the association between acute infections and the development of ACS.

Myocardial expression of transforming growth factor beta family and endothelin-1 in the progression from heart failure to ascites in broilers with cold-induced pulmonary hypertension

Abstract We determined mRNA expression of genes of endothelin-1 (ET-1), and of the transforming growth factor beta ligands (TGFβ1, TGFβ2 and TGFβ3), their receptors (TβRI and TβRII) and their pseudoreceptor BAMBI in the heart of broilers raised under cold temperature conditions and affected by pulmonary hypertension. Gene expression was determined by RT-qPCR in right myocardial ventricle samples from 4-week-old chickens (n = 48) raised either under normal (control) or cold temperature conditions (22 °C versus 14 °C). We do not find differences among healthy birds, birds with cardiac failure and ascitic birds in the mRNA levels of TGFβ2, TGFβ3 and BAMBI. In the control group, ET-1 mRNA level was increased in the ascitic birds as compared with healthy birds and birds with cardiac failure (p < 0.05) whereas in the cold treated group, no increase was observed (p > 0.05); yet, ascitic birds in the cold group showed lower mean than ascitic birds in the control group (p < 0.05). TβRII mRNA expression was higher in ascitic than in healthy birds (p < 0.05) in both control and cold treated groups; however, in the ascitic birds of the cold treated group TβRII expression was lower than in ascitic birds from the control group (p < 0.05). Thus, the higher ET-1 and TβRII levels observed in ascitic birds seem to be attenuated by cold.

Reduced numbers of circulating CD28‐negative CD4+ cells in patients with rheumatoid arthritis chronically treated with abatacept

Dear Editor, Rheumatoid arthritis (RA) is a chronic, autoimmune disorder characterized by premature immunosenescence. This includes increased numbers of circulating CD4+ T cells lacking CD28 expression, a key receptor for activating second signals delivered by antigenpresenting cells. Despite the role of CD28 to ensure appropriate activation, CD4+CD28 cells from RA patients remain functionally active and have been associated with severity of disease, presence of extra-articular manifestations and early atherosclerotic changes. Abatacept (CTLA-4Ig) is a T cell costimulation blocker demonstrated to be useful in the treatment of RA. After 48 weeks therapy, abatacept restores the expression of CD28 in CD4+ cells in parallel with clinical response, suggesting an active role for these cells. Nevertheless, whether the number of circulating CD4+CD28 cells remains reduced during long-term therapy, or it is a transient phenomenon, is unclear. Thus, our aimwas to investigate the number of circulating CD4+CD28 T cells in patients with RA under long-term therapy with abatacept. The present study was conducted in a single-center, outpatient rheumatology clinic. Patients with longlasting RA meeting the 1987 American College of Rheumatology classification criteria receiving abatacept for > 5 years with adequate clinical response were eligible. Also, disease activity-matched RA patients on successful therapy with disease modifying antirheumatic drugs (DMARDs) for > 5 years who have never received biological agents were included. Ten young, healthy individuals (seven female, median age 31 years) were included as reference. This protocol was approved by the local ethics committee and conducted in accordance with the Declaration of Helsinki. An informed consent was obtained from each participant. Demographics were obtained from medical charts. Examinations were performed by a rheumatologist (CR-A) blinded to laboratory results. Disease activity was assessed by the Disease Activity Score 28 – C-reactive protein (DAS28-CRP[3]) index. Peripheral blood mononuclear cells (PBMC) were isolated by density gradient and expression of surface markers was assessed by color flow-cytometry in a FACSCalibur (BD Biosciences, San Jose, CA, USA) using monoclonal antibodies against CD4 and CD28 molecules and conjugated with phycoerythrin and allophycocyanin, respectively (BioLegend, San Diego, CA, USA). Transcript levels were measured in PBMC by reverse transcription quantitative polymerase chain reaction (RT-qPCR), using the primers: TNF (NM_000594; forward-CAGCCTCTTCTCCTTCCTGA; reverse-GCCAGAGGGCTGATTAGAGA), NFjΒ1 (NM_0 01165412; forwardACCCTGACCTTGCCTATTT; reverse AGCTCTTTTTCCCGATCTCC) and GADPH (NM_0020 46.3; forward-AGCCACATCGCTCAGACAC; reverse GC CCAATACGACCAAATCC) and universal hydrolysis probes (Roche Diagnostics, Indianapolis, IN, USA). Serum levels of interferon gamma (IFN-c), interleukin (IL)-17, IL-1b, and IL-6 were tested by enzyme-linked immunosorbent assay (ELISA) (R&D Systems, Minneapolis, MN, USA), while high-sensitivity CRP was measured by nephelometry (Beckman Coulter, Fullerton, CA, USA). All experiments were performed in accordance with the manufacturers’ instructions. Discrete variables are expressed as percentages and differences calculated by v or Fisher’s exact tests, while continuous variables are described in medians (minimum to maximum range) and compared by Kruskall-Wallis (Dunn’s multiple comparison test) or Mann-Whitney tests as appropriate. P < 0.05 was set for significance and analyses were performed in GraphPad Prism 4.02 (GraphPad Inc, San Diego, CA, USA) software. The main data of participants are described in Table 1. As noted, patients receiving abatacept had less use of antimalarials (33% vs. 87%; P = 0.04). The abatacept group showed a trend for higher serum CRP (10.4, 0.8–116 vs. 3.5, 0.7–14.8 mg/L; P = ns) even when total disease activity score was similar between RA groups (DAS28-CRP[3] index 3.6, 2.1–5.5 vs. 3.5,

Over, and Underexpression of Endothelin 1 and TGF-Beta Family Ligands and Receptors in Lung Tissue of Broilers with Pulmonary Hypertension

Transforming growth factor beta (TGFβ) is a family of genes that play a key role in mediating tissue remodeling in various forms of acute and chronic lung disease. In order to assess their role on pulmonary hypertension in broilers, we determined mRNA expression of genes of the TGFβ family and endothelin 1 in lung samples from 4-week-old chickens raised either under normal or cold temperature conditions. Both in control and cold-treated groups of broilers, endothelin 1 mRNA expression levels in lungs from ascitic chickens were higher than levels from healthy birds (P < 0.05), whereas levels in animals with cardiac failure were intermediate. Conversely, TGFβ2 and TGFβ3 gene expression in lungs were higher in healthy animals than in ascitic animals in both groups (P < 0.05). TGFβ1, TβRI, and TβRII mRNA gene expression among healthy, ascitic, and chickens with cardiac failure showed no differences (P > 0.05). BAMBI mRNA gene expression was lowest in birds with ascites only in the control group as compared with the values from healthy birds (P < 0.05).

Type Iii Interferons in Systemic Lupus Erythematosus: Association Between Interferon λ3, Disease Activity, and Anti-ro/ssa Antibodies

Objective The aim of this study was to assess associations between serum type III (&lgr;) interferons (IFN-&lgr;) and disease activity in systemic lupus erythematosus (SLE). Methods Serum levels of IFN-&lgr;1, IFN-&lgr;2, and IFN-&lgr;3 were measured in 93 SLE patients and 67 healthy individuals. The associations with overall disease activity, organ-specific damage, and SLE-related antibodies were assessed. Results Median IFN-&lgr;1 levels were 0 pg/mL (range, 0–510 pg/mL) and 0 pg/mL (0–171 pg/mL; P = 0.814) in SLE patients and control subjects, respectively. These figures were 0 pg/mL (0–28 pg/mL) and 0 pg/mL (0–43 pg/mL; P = 0.659) for IFN-&lgr;2, as well as 83 pg/mL (0–965 pg/mL) and 42 pg/mL (0–520 pg/mL; P = 0.002) for IFN-&lgr;3, respectively. According to the Systemic Lupus Erythematosus Disease Activity Index categories, IFN-&lgr;3 levels were 44 pg/mL (0–158 pg/mL) in quiescent, 117 pg/mL (0–344 pg/mL) in mild, 79 pg/mL (0–965 pg/mL) in moderate, and 78 pg/mL (0–329 pg/mL) in severe disease, with the highest levels found in patients with serosal or cutaneous involvement. In line with this, IFN-&lgr;3 levels were inversely correlated with C3 (&rgr; = −0.44; 95% confidence interval, −0.62 to −0.20; P = 0.0003) and C4 (&rgr; = −0.40; 95% confidence interval, −0.59 to −0.15; P = 0.0001) complement proteins. In addition, higher IFN-&lgr;3 levels were found in patients positive for anti-Ro/SSA antibodies than in those negative for that antibody (122 pg/mL [0–965 pg/mL] vs. 0 pg/mL [0–165 pg/mL]; P = 0.001). The concentration of IFN-&lgr;3 also was higher in patients receiving glucocorticoids (104 pg/mL [0–965 pg/mL] vs. 30 pg/mL [0–165 pg/mL]; P = 0.009), and a dose-related effect was observed. Conclusions Interferon &lgr;3, a subtype of type III IFNs, is associated with the extent of lupus activity, in particular with active serosal and cutaneous disease. This association could be mechanistically related to anti-Ro/SSA antibodies.OBJECTIVE The aim of this study was to assess associations between serum type III (λ) interferons (IFN-λ) and disease activity in systemic lupus erythematosus (SLE). METHODS Serum levels of IFN-λ1, IFN-λ2, and IFN-λ3 were measured in 93 SLE patients and 67 healthy individuals. The associations with overall disease activity, organ-specific damage, and SLE-related antibodies were assessed. RESULTS Median IFN-λ1 levels were 0 pg/mL (range, 0-510 pg/mL) and 0 pg/mL (0-171 pg/mL; P = 0.814) in SLE patients and control subjects, respectively. These figures were 0 pg/mL (0-28 pg/mL) and 0 pg/mL (0-43 pg/mL; P = 0.659) for IFN-λ2, as well as 83 pg/mL (0-965 pg/mL) and 42 pg/mL (0-520 pg/mL; P = 0.002) for IFN-λ3, respectively. According to the Systemic Lupus Erythematosus Disease Activity Index categories, IFN-λ3 levels were 44 pg/mL (0-158 pg/mL) in quiescent, 117 pg/mL (0-344 pg/mL) in mild, 79 pg/mL (0-965 pg/mL) in moderate, and 78 pg/mL (0-329 pg/mL) in severe disease, with the highest levels found in patients with serosal or cutaneous involvement. In line with this, IFN-λ3 levels were inversely correlated with C3 (ρ = -0.44; 95% confidence interval, -0.62 to -0.20; P = 0.0003) and C4 (ρ = -0.40; 95% confidence interval, -0.59 to -0.15; P = 0.0001) complement proteins. In addition, higher IFN-λ3 levels were found in patients positive for anti-Ro/SSA antibodies than in those negative for that antibody (122 pg/mL [0-965 pg/mL] vs. 0 pg/mL [0-165 pg/mL]; P = 0.001). The concentration of IFN-λ3 also was higher in patients receiving glucocorticoids (104 pg/mL [0-965 pg/mL] vs. 30 pg/mL [0-165 pg/mL]; P = 0.009), and a dose-related effect was observed. CONCLUSIONS Interferon λ3, a subtype of type III IFNs, is associated with the extent of lupus activity, in particular with active serosal and cutaneous disease. This association could be mechanistically related to anti-Ro/SSA antibodies.

Improvement of cardiometabolic markers after fish oil intervention in young Mexican adults and the role of PPARα L162V and PPARγ2 P12A

Polyunsaturated fatty acids (PUFA) contained in fish oil (FO) are ligands for peroxisome proliferator-activated receptors (PPAR) that may induce changes in cardiometabolic markers. Variation in PPAR genes may influence the beneficial responses linked to FO supplementation in young adults. The study aimed to analyze the effect of FO supplementation on glucose metabolism, circulating lipids and inflammation according to PPARα L162V and PPARγ2 P12A genotypes in young Mexican adults. 191 young, non-smoking subjects between 18 and 40 years were included in a one-arm study. Participants were supplemented with 2.7 g/day of EPA+DHA, during six weeks. Dietary analysis, body composition measurements and indicators for glucose metabolism, circulating lipids, and markers for inflammation were analyzed before and after intervention. An overall decrease in triglycerides (TG) and an increase in HS-ω3 index were observed in all subjects [-4.1 mg/dL, (SD:±51.7), P=.02 and 2.6%, (SD:±1.2), P<.001 respectively]. Mean fasting insulin and glycated hemoglobin (HbA1c%) were significantly decreased in all subjects [-0.547mlU/L, (SD:±10.29), P=.034 and-0.07%, (SD:±0.3), P<.001 respectively], whereas there was no change in body composition, fasting glucose, adiponectin and inflammatory markers. Subjects carrying the minor alleles of PPARα L162V and PPARγ2 P12A had higher responses in reduction of TG and fasting insulin respectively. Interestingly, doses below 2.7 g/day (1.8 g/day) were sufficient to induce a significant reduction in fasting insulin and HbA1c% from baseline (P=.019 and P<.001). The observed responses in triglycerides and fasting insulin in the Mexican population give further evidence of the importance of FO supplementation in young people as an early step towards the prevention of cardiometabolic disease.

Interleukin 6 Is Associated with Pulmonary Involvement in Primary Sjögren’s Syndrome

Primary Sjogren’s syndrome (pSS) is an autoimmune disease characterized by lymphocytic infiltration leading to destruction of acinar and ductal cells and loss of glandular parenchyma. Although sicca symptoms are pivotal manifestations of pSS, extraglandular involvement also occurs. Pulmonary involvement in pSS consists of interstitial lung disease, obstructive small airway disease, pulmonary arterial hypertension (PAH), bullous disease, and lymphoma1. Recent evidence suggests that cytokine-mediated mechanisms are critical in pSS, but the precise cytokine pattern driving lung injury remains unclear2–4. Because of current availability of therapies that modulate selected cytokines, in-depth knowledge of the cytokine profile associated to specific tissue damage is necessary. We analyzed circulating concentrations of several prototypical TH1 [interferon-γ (IFN-γ)], TH2 [interleukin 4 (IL-4), IL-6, IL-10], and TH17 (IL-17) cytokines in patients with pSS according to the presence or absence of pulmonary involvement. From an outpatient cohort with pSS according to the preliminary classification criteria5 we selected patients who had pulmonary involvement demonstrated by high-resolution computed tomography scans of the lungs, and at least one of the following: pulmonary function test, spirometry, or lung biopsy. For comparisons, we selected age and gender-matched pSS patients without pulmonary manifestations and normal chest radiograph. We excluded … Address correspondence to Dr. L.M. Amezcua-Guerra; E-mail: lmamezcuag{at}gmail.com

Role of nitric oxide in vasovagal syncope. A puzzle solved but there could be another piece

To the Editor Stewart et al 1 reported a very ingenious study that finally demonstrated the previously controversial role of nitric oxide (NO) in vasovagal syncope (VVS). They used a different approach that certainly explains that they have obtained positive findings. They measured the effect on NO through an inhibitor of …