Richard L. Price

NK cells impede glioblastoma virotherapy through NKp30 and NKp46 natural cytotoxicity receptors

The role of the immune response to oncolytic Herpes simplex viral (oHSV) therapy for glioblastoma is controversial because it might enhance or inhibit efficacy. We found that within hours of oHSV infection of glioblastomas in mice, activated natural killer (NK) cells are recruited to the site of infection. This response substantially diminished the efficacy of glioblastoma virotherapy. oHSV-activated NK cells coordinated macrophage and microglia activation within tumors. In vitro, human NK cells preferentially lysed oHSV-infected human glioblastoma cell lines. This enhanced killing depended on the NK cell natural cytotoxicity receptors (NCRs) NKp30 and NKp46, whose ligands are upregulated in oHSV-infected glioblastoma cells. We found that HSV titers and oHSV efficacy are increased in Ncr1−/− mice and a Ncr1−/− NK cell adoptive transfer model of glioma, respectively. These results demonstrate that glioblastoma virotherapy is limited partially by an antiviral NK cell response involving specific NCRs, uncovering new potential targets to enhance cancer virotherapy.

E2f3a and E2f3b contribute to the control of cell proliferation and mouse development.

ABSTRACT The E2f3 locus encodes two Rb-binding gene products, E2F3a and E2F3b, which are differentially regulated during the cell cycle and are thought to be critical for cell cycle progression. We targeted the individual inactivation of E2f3a or E2f3b in mice and examined their contributions to cell proliferation and development. Chromatin immunoprecipitation and gene expression experiments using mouse embryo fibroblasts deficient in each isoform showed that E2F3a and E2F3b contribute to G1/S-specific gene expression and cell proliferation. Expression of E2f3a or E2f3b was sufficient to support E2F target gene expression and cell proliferation in the absence of other E2F activators, E2f1 and E2f2, suggesting that these isoforms have redundant functions. Consistent with this notion, E2f3a−/− and E2f3b−/− embryos developed normally, whereas embryos lacking both isoforms (E2f3−/−) died in utero. We also find that E2f3a and E2f3b have redundant and nonredundant roles in the context of Rb mutation. Analysis of double-knockout embryos suggests that the ectopic proliferation and apoptosis in Rb−/− embryos is mainly mediated by E2f3a in the placenta and nervous system and by both E2f3a and E2f3b in lens fiber cells. Together, we conclude that the contributions of E2F3a and E2F3b in cell proliferation and development are context dependent.

MicroRNA-128 coordinately targets Polycomb Repressor Complexes in glioma stem cells

BACKGROUND The Polycomb Repressor Complex (PRC) is an epigenetic regulator of transcription whose action is mediated by 2 protein complexes, PRC1 and PRC2. PRC is oncogenic in glioblastoma, where it is involved in cancer stem cell maintenance and radioresistance. METHODS We used a set of glioblastoma patient samples, glioma stem cells, and neural stem cells from a mouse model of glioblastoma. We characterized gene/protein expression and cellular phenotypes by quantitative PCR/Western blotting and clonogenic, cell-cycle, and DNA damage assays. We performed overexpression/knockdown studies by lentiviral infection and microRNA/small interfering RNA oligonucleotide transfection. RESULTS We show that microRNA-128 (miR-128) directly targets mRNA of SUZ12, a key component of PRC2, in addition to BMI1, a component of PRC1 that we previously showed as a target as well. This blocks the partially redundant functions of PRC1/PRC2, thereby significantly reducing PRC activity and its associated histone modifications. MiR-128 and SUZ12/BMI1 show opposite expression in human glioblastomas versus normal brain and in glioma stemlike versus neural stem cells. Furthermore, miR-128 renders glioma stemlike cells less radioresistant by preventing the radiation-induced expression of both PRC components. Finally, miR-128 expression is significantly reduced in neural stem cells from the brain of young, presymptomatic mice in our mouse model of glioblastoma. This suggests that loss of miR-128 expression in brain is an early event in gliomagenesis. Moreover, knockdown of miR-128 expression in nonmalignant mouse and human neural stem cells led to elevated expression of PRC components and increased clonogenicity. CONCLUSIONS MiR-128 is an important suppressor of PRC activity, and its absence is an early event in gliomagenesis.

The Histone Deacetylase Inhibitor Valproic Acid Lessens NK Cell Action against Oncolytic Virus-Infected Glioblastoma Cells by Inhibition of STAT5/T-BET Signaling and Generation of Gamma Interferon

ABSTRACT Tumor virotherapy has been and continues to be used in clinical trials. One barrier to effective viral oncolysis, consisting of the interferon (IFN) response induced by viral infection, is inhibited by valproic acid (VPA) and other histone deacetylase inhibitors (HDACi). Innate immune cell recruitment and activation have been shown to be deleterious to the efficacy of oncolytic herpes simplex virus (oHSV) infection, and in this report we demonstrate that VPA limits this deleterious response. VPA, administered prior to oHSV inoculation in an orthotopic glioblastoma mouse model, resulted in a decline in NK and macrophage recruitment into tumor-bearing brains at 6 and 24 h post-oHSV infection. Interestingly, there was a robust rebound of recruitment of these cells at 72 h post-oHSV infection. The observed initial decline in immune cell recruitment was accompanied by a reduction in their activation status. VPA was also found to have a profound immunosuppressive effect on human NK cells in vitro. NK cytotoxicity was abrogated following exposure to VPA, consistent with downmodulation of cytotoxic gene expression of granzyme B and perforin at the mRNA and protein levels. In addition, suppression of gamma IFN (IFN-γ) production by VPA was associated with decreased STAT5 phosphorylation and dampened T-BET expression. Despite VPA-mediated immune suppression, mice were not at significantly increased risk for HSV encephalitis. These findings indicate that one of the avenues by which VPA enhances oHSV efficacy is through initial suppression of immune cell recruitment and inhibition of inflammatory cell pathways within NK cells.

Cytomegalovirus Contributes to Glioblastoma in the Context of Tumor Suppressor Mutations

To study the controversial role of cytomegalovirus (CMV) in glioblastoma, we assessed the effects of murine CMV (MCMV) perinatal infection in a GFAP-cre; Nf1(loxP/+); Trp53(-/+) genetic mouse model of glioma (Mut3 mice). Early on after infection, MCMV antigen was predominantly localized in CD45+ lymphocytes in the brain with active viral replication and local areas of inflammation, but, by 7 weeks, there was a generalized loss of MCMV in brain, confirmed by bioluminescent imaging. MCMV-infected Mut3 mice exhibited a shorter survival time from their gliomas than control Mut3 mice perinatally infected with mock or with a different neurotropic virus. Animal survival was also significantly shortened when orthotopic gliomas were implanted in mice perinatally infected with MCMV versus controls. MCMV infection increased phosphorylated STAT3 (p-STAT3) levels in neural stem cells (NSC) harvested from Mut3 mice subventricular zone, and, in vivo, there was increased p-STAT3 in NSCs in MCMV-infected compared with control mice. Of relevance, human CMV (HCMV) also increased p-STAT3 and proliferation of patient-derived glioblastoma neurospheres, whereas a STAT3 inhibitor reversed this effect in vitro and in vivo. These findings thus associate CMV infection to a STAT3-dependent modulatory role in glioma formation/progression in the context of tumor suppressor mutations in mice and possibly in humans.

Cytomegalovirus Infection Leads to Pleomorphic Rhabdomyosarcomas in Trp53+/− Mice

Cytomegalovirus (CMV) has been detected in several human cancers, but it has not proven to be oncogenic. However, recent studies have suggested mechanisms through which cytomegalovirus may modulate the tumor environment, encouraging its study as a positive modifier of tumorigenesis. In this study, we investigated the effects of cytomegalovirus infection in Trp53 heterozygous mice. Animals were infected with murine cytomegalovirus (MCMV) after birth at 2 days (P2) or 4 weeks of age and then monitored for tumor formation. Mice injected at 2 days of age developed tumors at a high frequency (43%) by 9 months of age. In contrast, only 3% of mock-infected or mice infected at 4 weeks developed tumors. The majority of tumors from P2 MCMV-infected mice were pleomorphic rhabdomyosarcomas (RMS) harboring MCMV DNA, RNA, and protein. An examination of clinical cases revealed that human RMS (embryonal, alveolar, and pleomorphic) harbored human cytomegalovirus IE1 and pp65 protein as well as viral RNA. Taken together, our findings offer support for the hypothesis that cytomegalovirus contributes to the development of pleomorphic RMS in the context of Trp53 mutation, a situation that occurs with high frequency in human RMS.

Mutations in glioblastoma oncosuppressive pathways pave the way for oncomodulatory activity of cytomegalovirus

Over the last decade, cytomegalovirus (CMV) has been suggested to promote the development of glioblastoma multiforme (GBM). Recent evidence demonstrates that CMV contributes to the progression of GBM in the context of oncosuppressor gene mutations. This finding provides further insights into the mechanisms whereby CMV exacerbates the malignancy of GBM.

Evolution of Malignant Glioma Treatment: From Chemotherapy to Vaccines to Viruses

Malignant glioma is the most common type and most severe form of primary brain cancer. Each year, around 17,000 new patients are diagnosed in the United States, or about 5 cases in 100,000 people 1. The disease most commonly occurs in the sixth through eighth decades of life. The prevalence of the disease will increase with an aging populace. According to the World Health Organization classification system, grade III and IV gliomas are collectively termed malignant gliomas 2. Grade III gliomas are anaplastic high-grade gliomas and grade IV tumors are glioblastomas. Glioblastoma accounts for about 80% of malignant gliomas 1, 3. Glioblastoma carries a worse prognosis and is characterized histologically by vascular proliferation and necrosis. The median survival for a patient with glioblastoma is only about 14 months with a 5-year survival rate near zero 4. Median survival for grade III gliomas is two to five years 5. Glioblastomas are classified as either primary or secondary glioblastomas 6. Primary tumors (>90%) arise de novo without previous medical evidence of lower tumor grade formation, whereas secondary glioblastomas develop from a lower grade (II or III) glioma. Primary and secondary classification only refers to the progression pathway to glioblastoma development; the histopathology for the tumors is the same. Regardless of being a primary or secondary glioblastoma, the prognosis and current treatment is the same. Recent research has suggested differences in the tumors 6. These tumors develop at different ages and are comprised of different genetic mutations 7, 8. Each tumor type has different molecular signatures as well. Primary glioblastomas are characterized by the EGFR/PTEN/Akt/mTOR pathway 9. Amplification of EGFR occurs in 60% of these tumors, but is seldom seen in secondary tumors 10, 11. Secondary glioblastomas are primarily characterized by point mutations in the TP53 tumor suppressor pathway 11. Recently, isocitrate dehydrogenase 1 (IDH1) mutations have been discovered in secondary glioblastomas 12. Interestingly, presence of this mutation signifies a more favorable prognosis 13. The genetic signatures between primary and secondary tumors suggest underlying distinctions that may potentially guide targeted therapy in the future. Recent research has focused on further defining the genetics of malignant gliomas14. No unequivocal causal mutations of malignant gliomas have been discovered. Instead, the tumor appears to be induced by an accumulation of multiple mutations over time. As opposed to identifying specific mutations, identification of altered molecular pathways and how the pathways interact is much more informative. Integrated pathway analyses have determined important genetic pathways implicated in glioblastoma 15, 16. Genetic alterations in the RTK/RAS/PI(3)K pathway are most common, affecting 88% of glioblastomas. Signaling alterations in the p53 and RB pathways are second and third most frequent, altered in 87% and 78% of cases, respectively. Besides determining genes promoting gliomagenesis, other studies have shown how genes can serve as prognostic indicators. Several prognostic markers have been shown to correlate with glioblastoma survival. For instance, glioblastoma patients with IDH1 mutations survive longer compared to patients without mutations in this gene 12.

Human Cytomegalovirus is Present in Alveolar Soft Part Sarcoma.

Alveolar soft part sarcoma (ASPS) is an exquisitely rare sarcoma of unknown histogenesis, with a predilection for adolescents and young adults, characterized by slow progressive clinical course and high frequency of metastases. They are traditionally chemoresistant with very limited treatment options in the metastatic setting. Human cytomegalovirus (HCMV) is a DNA &bgr;-herpes virus and it is characterized by persistent lifelong and latent infection. There is growing evidence to indicate the presence of HCMV proteins and nucleic acids in glioblastoma, medulloblastoma, rhabdomyosarcoma, and a variety of solid organ malignancies of the breast, prostate, lung, and colon at very high prevalence. Immunotherapy-based clinical trials targeting specific cytomegalovirus proteins are currently in progress in the treatment of glioblastoma. Herein, we evaluated for the presence of HCMV proteins (IE1 and pp65), genes (US28 and UL96), and RNA in a cohort of ASPS. Six confirmed cases of ASPS were retrieved and full thickness sections of formalin-fixed paraffin-embedded material were stained for anti-HMCV-IE1 and anti-HCMV-pp65. Any nuclear and/or cytoplasmic staining was considered positive. DNA was purified from 50 µm of formalin-fixed paraffin-embedded material. One hundred nanogram of DNA was amplified using polymerase chain reaction for primers specific to HCMV-US28 (forward: AGCGTGCCGTGTACGTTAC and reverse: ATAAAGACAAGCACGACC) and HCMV-UL96 (forward: ACAGCTCTTAAAGGACGTGATGCG and reverse: ACCGTGTCCTTCAGCTCGGTTAAA) using Promega Taq polymerase. HCMV in situ hybridization was performed. All 6 cases of ASPS were positive for both HCMV-IE1 and HCMV-pp65. Usable DNA was available in 4 of the 6 cases. HCMV-US28 gene was found in 75% (3/4) of cases and HCMV-UL96 gene was detected in 50% (2/4) of cases. Importantly, all cases tested positive for at least 1 gene. HCMV-encoded RNA was identified in 80% (4/5) of cases. The presence of HCMV DNA, RNA along with HCMV protein indicates that HCMV is present in ASPS and may contribute to its pathogenesis.

Modeling Cytomegalovirus Infection in Mouse Tumor Models

The hypothesis that cytomegalovirus (CMV) modulates cancer is evolving. Originally discovered in glioblastoma in 2002, the number of cancers, where intratumoral CMV antigen is detected, has increased in recent years suggesting that CMV actively affects the pathobiology of certain tumors. These findings are controversial as several groups have also reported inability to replicate these results. Regardless, several clinical trials for glioblastoma are underway or have been completed that target intratumoral CMV with anti-viral drugs or immunotherapy. Therefore, a better understanding of the possible pathobiology of CMV in cancer needs to be ascertained. We have developed genetic, syngeneic, and orthotopic malignant glioma mouse models to study the role of CMV in cancer development and progression. These models recapitulate for the most part intratumoral CMV expression as seen in human tumors. Additionally, we discovered that CMV infection in Trp53−/+ mice promotes pleomorphic rhabdomyosarcomas. These mouse models are not only a vehicle for studying pathobiology of the viral-tumor interaction but also a platform for developing and testing cancer therapeutics.