Ronan O'Malley

Highly Integrated Single-Base Resolution Maps of the Epigenome in Arabidopsis

Deciphering the multiple layers of epigenetic regulation that control transcription is critical to understanding how plants develop and respond to their environment. Using sequencing-by-synthesis technology we directly sequenced the cytosine methylome (methylC-seq), transcriptome (mRNA-seq), and small RNA transcriptome (smRNA-seq) to generate highly integrated epigenome maps for wild-type Arabidopsis thaliana and mutants defective in DNA methyltransferase or demethylase activity. At single-base resolution we discovered extensive, previously undetected DNA methylation, identified the context and level of methylation at each site, and observed local sequence effects upon methylation state. Deep sequencing of smRNAs revealed a direct relationship between the location of smRNAs and DNA methylation, perturbation of smRNA biogenesis upon loss of CpG DNA methylation, and a tendency for smRNAs to direct strand-specific DNA methylation in regions of RNA-DNA homology. Finally, strand-specific mRNA-seq revealed altered transcript abundance of hundreds of genes, transposons, and unannotated intergenic transcripts upon modification of the DNA methylation state.

Phased diploid genome assembly with single-molecule real-time sequencing

While genome assembly projects have been successful in many haploid and inbred species, the assembly of noninbred or rearranged heterozygous genomes remains a major challenge. To address this challenge, we introduce the open-source FALCON and FALCON-Unzip algorithms (https://github.com/PacificBiosciences/FALCON/) to assemble long-read sequencing data into highly accurate, contiguous, and correctly phased diploid genomes. We generate new reference sequences for heterozygous samples including an F1 hybrid of Arabidopsis thaliana, the widely cultivated Vitis vinifera cv. Cabernet Sauvignon, and the coral fungus Clavicorona pyxidata, samples that have challenged short-read assembly approaches. The FALCON-based assemblies are substantially more contiguous and complete than alternate short- or long-read approaches. The phased diploid assembly enabled the study of haplotype structure and heterozygosities between homologous chromosomes, including the identification of widespread heterozygous structural variation within coding sequences.

Forward and Reverse Genetics through Derivation of Haploid Mouse Embryonic Stem Cells

All somatic mammalian cells carry two copies of chromosomes (diploidy), whereas organisms with a single copy of their genome, such as yeast, provide a basis for recessive genetics. Here we report the generation of haploid mouse ESC lines from parthenogenetic embryos. These cells carry 20 chromosomes, express stem cell markers, and develop into all germ layers in vitro and in vivo. We also developed a reversible mutagenesis protocol that allows saturated genetic recessive screens and results in homozygous alleles. This system allowed us to generate a knockout cell line for the microRNA processing enzyme Drosha. In a forward genetic screen, we identified Gpr107 as a molecule essential for killing by ricin, a toxin being used as a bioweapon. Our results open the possibility of combining the power of a haploid genome with pluripotency of embryonic stem cells to uncover fundamental biological processes in defined cell types at a genomic scale.

An adapter ligation-mediated PCR method for high-throughput mapping of T-DNA inserts in the Arabidopsis genome.

Agrobacterium transfer DNA (T-DNA) is an effective plant mutagen that has been used to create sequence-indexed T-DNA insertion lines in Arabidopsis thaliana as a tool to study gene function. Creating T-DNA insertion lines requires a dependable method for locating the site of insertion in the genome. In this protocol, we describe an adapter ligation-mediated PCR method that we have used to screen a mutant library and identify over 150,000 T-DNA insertional mutants; the method can also be applied to map individual mutants. The procedure consists of three steps: a restriction enzyme-mediated ligation of an adapter to the genomic DNA; a PCR amplification of the T-DNA/genomic DNA junction with primers specific to the adapter and T-DNA; and sequencing of the T-DNA/genomic junction to enable mapping to the reference genome. In most cases, the sequenced genomic region extends to the T-DNA border, enabling the exact location of the insert to be identified. The entire process takes 2 weeks to complete.

Erratum: Cistrome and Epicistrome Features Shape the Regulatory DNA Landscape (Cell (2016) 165(5) (1280–1292))

In the Supplemental Experimental Procedures, the Adaptor B sequence shown was missing the 50 phosphate modification required for ligation, and the Illumina TruSeq Index primer was shown as the reverse complement of the sequence used in the analyses. The correct sequences are: Adaptor B: 50 P-GATCGGAAGAGCACACGTCTG and TruSeq Index primer: 50-CAAGCAGAAGACGGCATAC GAGAT-NNNNNN GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC (where the NNNNNN represents the six-base-pair sequence index used for sample identification).

CrY2H-seq: a massively multiplexed assay for deep-coverage interactome mapping.

Broad-scale protein–protein interaction mapping is a major challenge given the cost, time, and sensitivity constraints of existing technologies. Here, we present a massively multiplexed yeast two-hybrid method, CrY2H-seq, which uses a Cre recombinase interaction reporter to intracellularly fuse the coding sequences of two interacting proteins and next-generation DNA sequencing to identify these interactions en masse. We applied CrY2H-seq to investigate sparsely annotated Arabidopsis thaliana transcription factors interactions. By performing ten independent screens testing a total of 36 million binary interaction combinations, and uncovering a network of 8,577 interactions among 1,453 transcription factors, we demonstrate CrY2H-seq′s improved screening capacity, efficiency, and sensitivity over those of existing technologies. The deep-coverage network resource we call AtTFIN-1 recapitulates one-third of previously reported interactions derived from diverse methods, expands the number of known plant transcription factor interactions by three-fold, and reveals previously unknown family-specific interaction module associations with plant reproductive development, root architecture, and circadian coordination.

Epiallelic Variation in Arabidopsis thaliana

Genotype is the primary determinate of phenotype. During the past two decades, however, there has been an emergent recognition of the epigenotype, a separate layer of heredity distinct from the primary DNA sequence that can have profound effects on phenotype. The epigenotype is a collection of chemical modifications to the DNA and nucleosomes in conjunction with noncoding RNA transcripts, and together these epigenetic marks act as a potent and expansive regulatory system for controlling gene expression. In this review, we discuss our current understanding of variation in epigenotype in the model plant Arabidopsis and how allelic differences attributable to epigenetic changes, or epialleles, can affect phenotype. We discuss examples of epialleles that have been created in the laboratory and others that have been identified in natural populations, because these two models provide complementary information regarding the genetic pathways, mechanisms of transmission, and biological and evolutionary context for the role of the epigenotype in phenotypic variation.

Mapping genome-wide transcription-factor binding sites using DAP-seq

To enable low-cost, high-throughput generation of cistrome and epicistrome maps for any organism, we developed DNA affinity purification sequencing (DAP-seq), a transcription factor (TF)-binding site (TFBS) discovery assay that couples affinity-purified TFs with next-generation sequencing of a genomic DNA library. The method is fast, inexpensive, and more easily scaled than chromatin immunoprecipitation sequencing (ChIP-seq). DNA libraries are constructed using native genomic DNA from any source of interest, preserving cell- and tissue-specific chemical modifications that are known to affect TF binding (such as DNA methylation) and providing increased specificity as compared with in silico predictions based on motifs from methods such as protein-binding microarrays (PBMs) and systematic evolution of ligands by exponential enrichment (SELEX). The resulting DNA library is incubated with an affinity-tagged in vitro-expressed TF, and TF–DNA complexes are purified using magnetic separation of the affinity tag. Bound genomic DNA is eluted from the TF and sequenced using next-generation sequencing. Sequence reads are mapped to a reference genome, identifying genome-wide binding locations for each TF assayed, from which sequence motifs can then be derived. A researcher with molecular biology experience should be able to follow this protocol, processing up to 400 samples per week.

Next Generation Protein Interactomes for Plant Systems Biology and Biomass Feedstock Research

In order to keep up with global energy demands, it is imperitive we acquire more knowledge of biofuel feedstocks for improving their cultivation and energy yield. Knowledge of protein-protein interaction (PPI) networks that promote robust plant growth or that are perturbed by pathogens causing disease could progress strategies for improving cultivation. However, current technologies available for obtaining PPI data are insufficient and unrealistic for non-model organisms because of time, cost, and sensitivity constraints. Even the largest high quality PPI map for the model plant Arabidopsis thaliana (Arabidopsis Interactome 1 or AI-1), that we generated, contains only 2% of all potential interactions, and took upwards of 5 years and

A Link between RNA Metabolism and Silencing Affecting Arabidopsis Development

8 million to finish. To address this problem, we are developing a next-generation sequencing integrated yeast two-hybrid (Y2H) system that will greatly improve the rate at which PPI data can be obtained and will be applicable to virtually any cell from which RNA can be extracted.