Ruhui Li

Phylogenetic relationships of closely related potyviruses infecting sweet potato determined by genomic characterization of Sweet potato virus G and Sweet potato virus 2

Complete nucleotide sequences of Sweet potato virus G (SPVG) and Sweet potato virus 2 (SPV2) were determined to be 10,800 and 10,731 nucleotides, respectively, excluding the 3′-poly(A) tail. Their genomic organizations are typical of potyviruses, encoding a polyprotein which is likely cleaved into 10 mature proteins by three viral proteinases. Conserved motifs of orthologous proteins of viruses in the genus Potyvirus are found in corresponding positions of both viruses. Pairwise comparisons of individual protein sequences of the two viruses with those of 78 other potyviruses show that P1 protein and coat protein (CP) of both viruses are significantly large, with the SPVG CP as the largest among the all the known species of the genus Potyvirus. The extended N-terminal region of the P1 protein is conserved in the potyviruses and ipomovirus infecting sweet potato. A novel ORF, PISPO, is identified within the P1 region of SPVG, SPV2, Sweet potato feathery mottle virus (SPFMV), and Sweet potato virus C (SPVC). The C-terminal half of CP is highly conserved among SPFMV, SPVC, SPVG, SPV2, and Sweet potato virus-Zimbabwe. Phylogenetic analysis based on the deduced CP amino acid sequences supports the view that these five viruses are grouped together in a SPFMV lineage. The analysis also reveals that Sweet potato virus Y and Ipomoea vein mosaic virus are grouped with SPV2 as one species, and these two viruses should be consolidated with SPV2.

Simultaneous detection and differentiation of four closely related sweet potato potyviruses by a multiplex one-step RT-PCR

Four closely related potyviruses, Sweet potato feathery mottle virus (SPFMV), Sweet potato virus C (SPVC), Sweet potato virus G (SPVG) and/or Sweet potato virus 2 (SPV2), are involved in sweet potato virus disease complexes worldwide. Identification and detection of these viruses are complicated by high similarity among their genomic sequences, frequent occurrence as mixed infections and low titer in many sweet potato cultivars. A one-tube multiplex reverse transcription-PCR (mRT-PCR) assay was developed for simultaneous detection and differentiation of SPFMV, SPVC, SPVG and SPV2. Four specific forward primers unique to each virus and one reverse primer based on the region conserved in all four viruses were selected and used in the assay. The mRT-PCR assay was optimized for primer concentration and cycling conditions. It was tested using sweet potato plants infected naturally with one to four target viruses and then evaluated using field samples collected from southwestern China. The mRT-PCR assay is reliable and sensitive as a simple, rapid and cost-effective method to detect these pathogens in sweet potato. This assay will be useful to quarantine and certification programs and virus surveys when large numbers of samples are tested.

The complete nucleotide sequence and genome organization of tomato infectious chlorosis virus: a distinct crinivirus most closely related to lettuce infectious yellows virus.

The complete nucleotide sequence of tomato infectious chlorosis virus (TICV) was determined and compared with those of other members of the genus Crinivirus. RNA 1 is 8,271 nucleotides long with three open reading frames and encodes proteins involved in replication. RNA 2 is 7,913 nucleotides long and encodes eight proteins common within the genus Crinivirus that are involved in genome protection, movement and other functions yet to be identified. Similarity between TICV and other criniviruses varies throughout the genome but TICV is related more closely to lettuce infectious yellows virus than to any other crinivirus, thus identifying a third group within the genus.

Elimination of five viruses from sugarcane using in vitro culture of axillary buds and apical meristems

Procedures were developed for the in vitro elimination of Sugarcane mosaic virus (SCMV), Sorghum mosaic virus (SrMV), Sugarcane streak mosaic virus (SCSMV), Sugarcane yellow leaf virus (SCYLV) and Fiji disease virus (FDV) from infected sugarcane. In vitro shoot regeneration, elongation and virus elimination through meristem tissue culture originating from both apical and axillary shoots were compared. The average rates of regeneration and elongation from apical meristem tissues were 91 and 66%, respectively, with the virus-free rate among elongated shoots ranging from 61–92%. Mature axillary buds were cultivated in vitro to produce axillary shoots, from which meristem tissues were excised and cultured. These meristem tissues regenerated (77–100%) and elongated (55–88%) in culture medium at approximately the same rate as the apical meristems. The average virus elimination rate was 90% among elongated shoots derived from mature axillary buds. All five viruses can be eliminated by meristem tissue culture from both apical and axillary shoots using a standardized procedure. The overall average efficiency of virus-free plant production was 45 and 58% from apical and axillary shoots, respectively. There were no significant differences for shoot induction or virus elimination when the meristems were harvested from either the apical or the axillary shoots. This is the first report of SrMV or SCSMV elimination from sugarcane, as well as elimination of any mixed virus infections. This new method of harvesting meristems from axillary buds greatly expands the amount of material available for therapeutic treatments and thereby increases the probability of eliminating viruses from infected sugarcane.

First report of tomato mottle mosaic virus infection of pepper in China.

Tomato mottle mosaic virus (ToMMV), a tentative member in genus Tobamovirus, was first reported from a greenhouse tomato sample collected in Mexico in 2013 (2). In August 2013, foliar mottle, shrinking, and necrosis were observed on pepper plants in several vegetable greenhouses of Lhasa, Tibet Autonomous Region, China. Seven symptomatic samples were collected and tested by dot-blot ELISA with antisera against Cucumber mosaic virus, Tobacco mosaic virus (TMV), Cucumber green mottle mosaic virus, Tomato spotted wilt virus, Turnip mosaic virus, and Broad bean wilt virus 2 (kindly provided by Dr. Xueping Zhou of Zhejiang University, China) (3). One of the bell pepper (Capsicum annuum var. grossum) samples reacted with the TMV antibody. Rod-shaped virus particles 300 nm in length were observed in this sample under electron microscopy. The results suggested that a tobamovirus closely related to TMV might be a causal agent. Total nucleic acids were then extracted from all seven samples using a CTAB method (1) and tested by RT-PCR using a pair of tobamovirus degenerate primers, TobamoF (GCWAAGGTKGTWYTBGTRGAYGG) and TobamoR (GTAATTGCTATTGDGTWCCWGC). These two primers were designed according to a conserved region of the TMV, Tomato mosaic virus, and ToMMV genomes (nt 2551-3433 of ToMMV genome [KF477193]). An amplicon of approximately 880 bp was obtained only from the TMV-positive sample. The amplicon was cloned and sequenced (GenBank Accession No. KJ605653). NCBI BLAST search showed that it shared the highest identity (99%) with ToMMV (KF477193), and shared the sequence homology of 82% to Tomato mosaic virus (AF332868) and 77% to TMV (V01408). The results indicated that the symptomatic pepper was infected with ToMMV. To investigate the distribution and incidence of ToMMV, 313 samples of symptomatic pepper, tomato, pumpkin, cucumber, radish, Chinese cabbage, broad bean, pea, and kidney bean samples were collected from 65 fields in Yunnan Province and Tibet Autonomous Region, and tested in RT-PCR with ToMMV-specific primers ToMMVF (AGAGAGATGGCGATAGGTTAAC, identical to nt 830-851 of ToMMV genome, GenBank Accession No. KF477193) and ToMMVR (CTGCAGTCATAGGATCTACTTC, complementary to nt1849-1828). The virus was detected in three tabasco peppers (C. frutescens) from Yunnan and one bell pepper plant from Tibet, suggesting that ToMMV has a restricted host range and is not common in these two regions. To our knowledge, this is the first report of natural infection of ToMMV in peppers as well as in China. References: (1) R. Li et al. J. Virol. Methods 154:48, 2008. (2) R. Li et al. Genome Announc. 1(5):e00794-13, 2013. (3) Y. Xie et al. Virol. J. 10:142, 2013.

Simultaneous detection of four causal agents of tobacco bushy top disease by a multiplex one-step RT-PCR.

Tobacco bushy top disease is a complex disease caused by mixed infection of Tobacco bushy top virus (TBTV), Tobacco vein distorting virus (TVDV), satellite RNA of TBTV (Sat-TBTV) and Tobacco vein distorting virus associate RNA (TVDVaRNA). A one-tube multiplex reverse transcription-PCR (RT-PCR) assay was developed for simultaneous detection of the four causal agents of the disease. Four pairs of specific primers based on the conserved regions of each of the four disease agents were used in the one-tube RT-PCR. The RT-PCR products consisted of fragments of 1049 base pairs (bp) for TBTV, 792bp for TVDVaRNA, 598bp for Sat-TBTV and 357bp for TVDV, and their origins were confirmed by sequencing. Primer concentrations and cycling condition were optimized for the multiplex RT-PCR. The detection limit of the assay was up to 10(-4) dilution. The assay was evaluated using tobacco plants infected naturally with one to four target viruses, transmission vector of aphids and field samples collected from Yunnan, Hunan, and Guizhou province, China. The results show that the multiplex RT-PCR is reliable and sensitive as a simple, rapid and cost-effective method to detect these pathogens in tobacco and aphid. This assay will be useful for virus surveys when large numbers of samples are tested.

Development of a multiplex TaqMan real-time RT-PCR assay for simultaneous detection of Asian prunus viruses, plum bark necrosis stem pitting associated virus, and peach latent mosaic viroid

Asian prunus viruses (APV 1, APV 2 and APV 3), Plum bark necrosis stem pitting associated virus (PBNSPaV) and Peach latent mosaic viroid (PLMVd) are pathogens that infect Prunus species. A single-tube multiplex, TaqMan real-time RT-PCR assay was developed for the simultaneous detection and identification of these pathogens. The protocol includes amplification and detection of a fluorogenic cytochrome oxidase gene (COX) as an internal control. The results of the multiplex TaqMan RT-PCR assay correlated with those from conventional RT-PCR, with a 10-fold increase in sensitivity in the multiplex real-time format. The efficiency and accuracy of the assay was evaluated by testing stone fruit trees from positive control collections and several orchard locations. Several mixed infections of target pathogens were detected in peach orchard samples. This assay is simple, rapid and cost-effective and can be used by quarantine and certification programs where numerous stone fruit trees need to be tested for these pathogens.

Molecular characterization of a novel luteovirus from peach identified by high-throughput sequencing

Contigs with sequence homologies to cherry-associated luteovirus were identified by high-throughput sequencing analysis in two peach accessions. Complete genomic sequences of the two isolates of this virus were determined to be 5,819 and 5,814 nucleotides long, respectively. The genome of the new virus is typical of luteoviruses, containing eight open reading frames in a very similar arrangement. Its genomic sequence is 58-74% identical to those of other members of the genus Luteovirus. These sequences thus belong to a new virus, which we have named “peach-associated luteovirus”.

Complete genome sequence of Celery mosaic virus and its relationship to other members of the genus Potyvirus

The complete genomic sequence of Celery mosaic virus (CeMV) was found to be 9999 nucleotides in length, excluding the 3′ poly(A) tail. The genome contains a single large open reading frame encoding a polyprotein of 3181 amino acids. Its genomic organization is typical of potyviruses and contains conserved motifs found in members of the genus Potyvirus. Pairwise comparison of the polyprotein sequences shows that CeMV shares 39.0-71.9% sequence identity with other members of the genus Potyvirus. Phylogenetic analysis based on the polyprotein sequences indicates that CeMV is most closely related to Apium virus Y, and together with Panax virus Y, the three viruses form a distinct clade.

Molecular characterization of a novel luteovirus infecting apple by next-generation sequencing

A new single-stranded positive-sense RNA virus, which shares the highest nucleotide (nt) sequence identity of 53.4% with the genome sequence of cherry-associated luteovirus South Korean isolate (ChALV-SK, genus Luteovirus), was discovered in this work. It is provisionally named apple-associated luteovirus (AaLV). The complete genome sequence of AaLV comprises 5,890 nt and contains eight open reading frames (ORFs), in a very similar arrangement that is typical of members of the genus Luteovirus. When compared with other members of the family Luteoviridae, ORF1 of AaLV was found to encompass another ORF, ORF1a, which encodes a putative 32.9-kDa protein. The ORF1-ORF2 region (RNA-dependent RNA polymerase, RdRP) showed the greatest amino acid (aa) sequence identity (59.7%) to that of cherry-associated luteovirus Czech Republic isolate (ChALV-CZ, genus Luteovirus). The results of genome sequence comparisons and phylogenetic analysis, suggest that AaLV should be a member of a novel species in the genus Luteovirus. To our knowledge, it is the sixth member of the genus Luteovirus reported to naturally infect rosaceous plants.