Theodore C. Simon

Intestinal epithelial cell differentiation: new insights from mice, flies and nematodes

Decisions commonly made during development that affect proliferation, cell fate specification, differentiation, migration, and death are made repeatedly in the mouse small intestinal epithelium throughout adulthood. The results of these decisions are a stratification of proliferation, differentiation, and death along the mouse small intestines crypt/villus axis. Recent genetic studies in Caenorhabditis elegans and Drosophila melanogaster have identified factors involved in determining cell fate and differentiation in gut endoderm. The stem cell hierarchy of the adult mouse intestinal epithelium makes it ideally suited for using chimeric animals to examine the functions of homologs of these lower eukaryotic (and other) proteins.

Universal PCR genotyping assay that achieves single copy sensitivity with any primer pair.

We have modified conditions typically utilized for long and accurate PCR (Cheng et al., 1994) to develop a sensitive and robust assay for genotyping genetically altered mice. This simplified assay provides a single set of conditions for all primer sets, and all primers chosen will work at single copy sensitivity. Primers are chosen to be 27–30 nucleotides in length with 50–60% guanosine/cytosine content and produce a 100–500 nucleotide amplicon. Primers that meet these conditions will achieve single copy sensitivity (Figure 1). Over 40 primer sets have been −−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−→ Figure 1. Detection of a single copy LacZ insertion (Panel (A)), cre transgene (Panel (B)), or single copy neo insertion in genomic DNA (Panel (C)). The PCR assay applied to a litter of mice from each genotype is shown. Internal control primers produce an amplimer in all samples from the intestinal fatty acid binding protein gene (Fabpi). Lane M is molecular weight standards spanning every 100 bp from 100–1000. LacZ primers are GTTGCAGTGCACGGCAGATACACTTGCTGA, GCCACTGGT GTGGGCCATAATTCAATTCGC cre primers are GCATTACCGGTCGATGCAACGAGTGATGAG, GAGTGAACG AACCTGGTCGAAATCAGTGCG neo primers are TGCTCCTGCCGAGAAAGTATCCATCATGGC, CGCCAAGCT CTTCAGCAATATCACGGGTAG. Fabpi primers are TGGACAGGACTGGACCTCTGCTTTCCTAGA, TAGAGCTTT GCCACATCACAGGTCATTCAG.

Regulation of rat liver fatty acid binding protein gene in liver, intestine, and kidney by HNF-1, GATA factors, and steroid hormone receptors

with control animals was seen in stomach or colon of TNAP-/animals, but the content was only about half in small bowel producing lAP. Transmission electron microscopy of the TNAP-/small bowel showed large dilated Iysosomes and residual bodies. Colon from the same animals showed mitochondria containing homogeneous dense inclusions, consistent with neutral lipid. In the underweight animals there was a decrease in the neuronal content of submucosal ganglia in the jejunum and ileum and of myenteric ganglia in the jejunum of TNAP-/animals. Conclusions: I)TNAP is not important in maintaining surfactant-like particle content of tissues that express TNAP e.g. stomach and colon; 2) Normal fat absorption is important in maitaining SLP content in the small intestine; 3)TNAP is important in the maintenance of some intestinal structures, and perhaps their function.