Xiao-yue Wang

A Nucleotide Signature for the Identification of American Ginseng and Its Products.

American ginseng (derived from Panax quinquefolius) is one of the most widely used medicinal herbs in the world. Because of its high price and increasing demand, there are many adulterants on the market. The proposed internal transcribed spacer 2 (ITS2) has been used to identify raw medicinal materials, but it is not suitable for the identification of Chinese patent medicine ingredients. Therefore, a short barcode for the identification of processed American ginseng and its corresponding Chinese patent medicines would be profitable. In this study, 94 samples of American ginseng and Asian ginseng were collected from all over the world. The ITS2 region was sequenced, and a nucleotide signature was developed based on one single nucleotide polymorphism (SNP) site unique to American ginseng. The nucleotide signature (atcactcctt tgcgggagtc gaggcgg) consists of 27 bases over the length of the ITS2 sequence (420 bp). Furthermore, we also designed primer pairs to amplify the nucleotide signature; the specific primer pair 4F/4R has been found to be unique to the ginseng species and capable of amplifying the nucleotide signatures from Chinese patent medicines and decoctions. We used the nucleotide signature method to inspect ginseng products in Chinese patent medicines; 24 batches of Chinese patent medicine from stores in Beijing were amplified and sequenced successfully. Using the double peaks at the SNP sites of the nucleotide signature, 5 batches were found to be counterfeits, and 2 batches were found to contain adulterants. Thus, this nucleotide signature, with only 27 bp, has broadened the application of DNA barcoding in identification of decoctions, Chinese patent medicines and other ginseng products with degraded DNA. This method can rapidly identify ginseng products and could also be developed as an on-site detection method.

A Nucleotide Signature for the Identification of Angelicae Sinensis Radix (Danggui) and Its Products

It is very difficult to identify Angelicae sinensis radix (Danggui) when it is processed into Chinese patent medicines. The proposed internal transcribed spacer 2 (ITS2) is not sufficient to resolve heavily processed materials. Therefore, a short barcode for the identification of processed materials is urgently needed. In this study, 265 samples of Angelicae sinensis radix and adulterants were collected. The ITS2 region was sequenced, and based on one single nucleotide polymorphism(SNP) site unique to Angelica sinensis, a nucleotide signature consisting of 37-bp (5′-aatccgcgtc atcttagtga gctcaaggac ccttagg-3′) was developed. It is highly conserved and specific within Angelica sinensis while divergent among other species. Then, we designed primers (DG01F/DG01R) to amplify the nucleotide signature region from processed materials. 15 samples procured online were analysed. By seeking the signature, we found that 7 of them were counterfeits. 28 batches of Chinese patent medicines containing Danggui were amplified. 19 of them were found to contain the signature, and adulterants such as Ligusticum sinense, Notopterygium incisum, Angelica decursiva and Angelica gigas were detected in other batches. Thus, this nucleotide signature, with only 37-bp, will broaden the application of DNA barcoding to identify the components in decoctions, Chinese patent medicines and other products with degraded DNA.

Derivative Technology of DNA Barcoding (Nucleotide Signature and SNP Double Peak Methods) Detects Adulterants and Substitution in Chinese Patent Medicines

Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it’s not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5′ CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3′) was developed derived from ITS2 region of Eucommiae Folium based on unique motifs. Mixtures of powdered Lonicerae japonicae Flos and Lonicerae Flos resulted in double peaks at the expected SNP (Single Nucleotide Polymorphisms) positions, of which the height of the peaks were roughly indicative of the species’ ratio in the mixed powder. Subsequently we tested 20 extracts and 47 CPMs labelled as containing some species of Lonicera. The results revealed only 17% of the extracts and 22% of the CPMs were authentic, others exist substitution or adulterant; 7% were shown to contain both of two adulterants Eucommiae Folium and Lonicerae Flos. The methods developed in this study will widely broaden the application of DNA barcode in quality assurance of natural health products.

Detection of Ophiocordyceps sinensis and Its Common Adulterates Using Species-Specific Primers

Ophiocordyceps sinensis is a fungus that infects Hepialidae caterpillars, mummifying the larvae and producing characteristic fruiting bodies (stromata) that are processed into one of the most valued traditional Chinese medicines (TCM). The product commands a very high price due to a high demand but a very limited supply. Adulteration with other fungi is a common problem and there is a need to test preparation for the presence of the correct fungus. In the current study, a PCR-based approach for the identification of O. sinensis based on a segment of the internal transcribed spacer (ITS) region was developed. The segments is 146-bp in size and is likely to be amplified even in materials where processing led to DNA fragmentation. Primer development was based on the alignment of sequence data generated from a total of 89 samples of O. sinensis and potential adulterants as well as sequences date from 41 Ophiocordyceps species and 26 Cordyceps species available in GenBank. Tests with primer pair, DCF4/DCR4, demonstrated generation of an amplicon from DNA extracted from O. sinensis stromata, but not from extracts derived from adulterants. Species-specific primer pairs were also developed and tested for detection of the common adulterants, Cordyceps gunnii, Cordyceps cicadae, Cordyceps militaris, Cordyceps liangshanensis and Ophiocordyceps nutans. The collection of primers developed in the present study will be useful for the authentication of preparation claiming to only contain O. sinensis and for the detection of fungi used as adulterants in these preparations.

Authenticity Survey of Cuscutae Semen on Markets Using DNA Barcoding

Abstract Objective Using authentic raw herbal materials is fundamental to herbal medicine quality. Cuscuta chinensis and C. australis are two important species of Cuscutae Semen recorded in Chinese Pharmacopoeia. Due to having tiny bodies of seeds, it is extremely difficult to differentiate them from adulterants and closely related species by morphologic characteristics, leading to serious safety problems. Methods In this study, we developed a fast and efficient method to identify Cuscutae Semen on the market. First, a total of 207 ITS2 sequences representing 45 related species of Cuscutae Semen were collected to construct a standard DNA barcode database, then 33 commercial samples purchased from markets were analyzed by BLAST, and Neighbor-joining tree was used to verify the efficacy of the database. Results The percentage of counterfeits and adulterants in the 33 commercial samples were up to 69.7%, and only 10 commercial products were found to be genuine. The adulterated species included 11 species ( Amaranthus hybridus, Brassica carinata, Brassica juncea var. megarrhiza, Chenopodium album, Corispermum heptapotamicum, Cuscuta alata, Cuscuta japonica, Cuscuta monogyna, Foeniculum vulgare, Glycine max, and Medicago sativa ). Conclusion DNA barcoding is a fast and efficient method to identify Cuscutae Semen on the market.

Barcoding the Dendrobium (Orchidaceae) Species and Analysis of the Intragenomic Variation Based on the Internal Transcribed Spacer 2

Many species belonging to the genus Dendrobium are of great commercial value. However, their difficult growth conditions and high demand have caused many of these species to become endangered. Indeed, counterfeit Dendrobium products are common, especially in medicinal markets. This study aims to assess the suitability of the internal transcribed spacer 2 (ITS2) region as a marker for identifying Dendrobium and to evaluate its intragenomic variation in Dendrobium species. In total, 29,624 ITS2 copies from 18 species were obtained using 454 pyrosequencing to evaluate intragenomic variation. In addition, 513 ITS2 sequences from 26 Dendrobium species were used to assess its identification suitability. The highest intragenomic genetic distance was observed in Dendrobium chrysotoxum (0.081). The average intraspecific genetic distances of each species ranged from 0 to 0.032. Phylogenetic trees based on ITS2 sequences showed that most Dendrobium species are monophyletic. The intragenomic and intraspecies divergence analysis showed that greater intragenomic divergence is mostly correlated with larger intraspecific variation. As a major ITS2 variant becomes more common in genome, there are fewer intraspecific variable sites in ITS2 sequences at the species level. The results demonstrated that the intragenomic multiple copies of ITS2 did not affect species identification.

Rapid Authentication of Ginkgo biloba Herbal Products Using the Recombinase Polymerase Amplification Assay

Species adulteration in herbal products (HPs) exposes consumers to health risks. Chemical and morphological methods have their own deficiencies when dealing with the detection of species containing the same active compounds in HPs. In this study, we developed a rapid identification method using the recombinase polymerase amplification (RPA) assay to detect two species, Ginkgo biloba and Sophora japonica (as adulteration), in Ginkgo biloba HPs. Among 36 Ginkgo biloba HP samples, 34 were found to have Ginkgo biloba sequences, and 9 were found to have Sophora japonica sequences. During the authentication process, the RPA-LFS assay showed a higher specificity, sensitivity and efficiency than PCR-based methods. We initially applied the RPA-LSF technique to detect plant species in HPs, demonstrating that this assay can be developed into an efficient tool for the rapid on-site authentication of plant species in Ginkgo biloba HPs.

ITS2, a Better DNA Barcode than ITS in Identification of Species in Artemisia L.

Abstract Objective To select a more suitable DNA barcode to identify the species in Artemisia L. Methods ITS, ITS2, and three other major universal barcode candidates (matK, rbcL, and psbA-trnH) were evaluated in the identification efficiency using a total of 1433 sequences downloaded from GenBank representing 343 species in Artemisia L. ITS and ITS2 were evaluated in the PCR and sequencing rate, sequencing peak quality (Q value), and misread rate. One hundred and twelve A. annua samples were collected from 11 populations across over China, which were amplified with universal primers on the ITS and ITS2 regions. Results ITS and ITS2 shared a higher identification efficiency and exhibited 71.43% and 64.11% detectability at the species level, respectively. The Q values of ITS and ITS2 showed that the direct PCR sequencing data were reliable for the ITS2 region and ITS exhibited poor sequencing trace quality. In certain sites, the ITS sequences exhibited reading ambiguities and errors, indicating that the misread and deletion sites in the ITS region would incorrectly inflate the identification ratio. Conclusion ITS2 is a suitable barcode for identification of species in Artemisia L., which enlarges the optimal range of divergence levels for taxonomic inferences using ITS2 sequences.