Caterina Matteucci

Human homeobox gene HOXC13 is the partner of NUP98 in adult acute myeloid leukemia with t(11;12)(p15;q13)

The chimeric gene NUP98/HOXC13 was detected in a patient with a de novo acute myeloid leukemia and a t(11;12)(p15;q13). Fluorescence in situ hybridization with PAC1173K1 identified the breakpoint on 11p15, indicating that the NUP98 gene was involved in the translocation. At 12q13, the breakpoint fell within BAC 578A18, selected for the homeobox C (HOXC) cluster genes. RACE‐PCR showed that HOXC13 was the partner gene of NUP98. To date, HOXC13 is the eighth homeobox gene that, as the result of a reciprocal translocation, fuses with NUP98 in myeloid malignancies.

Typical genomic imbalances in primary MALT lymphoma of the orbit

Primary orbital non‐Hodgkin lymphoma is a mucosa‐associated lymphoid tissue (MALT)‐type extranodal marginal zone lymphoma. Little information is available on its genome as conventional cytogenetics is limited by scarce biopsy material, while fluorescence in situ hybridization (FISH) explores only selected regions. Comparative genomic hybridization (CGH) performs full genomic analysis and is applicable to different sources of DNA, such as fresh and frozen cells, as well as paraffin‐embedded tissues. In this study, CGH was used to analyse primary MALT lymphoma of the orbit. Aneuploidy was identified in six of the ten cases studied. Gains (19) were more frequent than losses (5). The most frequent duplications involved chromosome 3 (common region at 3q24‐qter), as expected in marginal zone lymphoma, and chromosome 6 (common region at 6p21.1–21.3), which is typical of an orbital location. Other chromosome gains were found at 1p, 7, 8q, 9q, 12, 13, 17, 18, 19, 22, and X. Losses were located at 1q, 6q, 9q, 11q, and 13q. Two cases showed isolated duplications of chromosome 6p or 9q. Isolated imbalances were found only in tumours affecting the conjunctiva. Complex aneuploidies were observed in lymphoma of the retro‐orbital tissue. In summary, CGH in orbital MALT lymphoma provided new insights into typical genomic imbalances and underlying pathogenetic mechanisms. Copyright

Role of BCL2L10 methylation and TET2 mutations in higher risk myelodysplastic syndromes treated with 5-azacytidine

Role of BCL2L10 methylation and TET2 mutations in higher risk myelodysplastic syndromes treated with 5-Azacytidine

TPM3/PDGFRB fusion transcript and its reciprocal in chronic eosinophilic leukemia.

Using metaphase fluorescence in situ hybridization (FISH) to narrow translocation breakpoints and polymerase chain reaction (PCR) to identify genes, we detected the TPM3 gene at 1q21 as a new PDGFRB partner in chronic eosinophilic leukemia (CEL). CEL is defined by a persistent eosinophil count X1.5 10/l with no known underlying causes, organ involvement, evidence of eosinophil clonality or increased blasts. In 30–40% of patients with male predominance and high incidence of hepatomegaly and splenomegaly, CEL is associated with del(4)(q12)/FIP1L1-PDGFRA genomic change. Rare cases show 5q31–q33 rearrangements, in a few of which PDGFRB is involved. Interestingly, a t(1;5)(q21;q33) disrupting PDGFRB has been reported in one case classified as atypical chronic myeloid leukemia (aCML)/CEL. In 1991, a 21-year-old man with CEL showed a 46,XY, t(1;5)(q21;q33) karyotype in 28/29 metaphases. Under a-interferon treatment, which was administered for 10 years, the patient obtained a major cytogenetic response. In April 2002, imatinib therapy provided hematological, cytogenetic and FISH remission, which was maintained until the last checkup in January 2005. Metaphase FISH was performed using a bone marrow sample taken at diagnosis. Cosmid 9-4 for the 30 PDGFRB (green) and cosmid 4-1 for the 50 PDGFRB (red) gave a red/green fusion signal on normal 5, a green signal on der(5) and a red signal on der(1) indicating PDGFRB was rearranged. The long arm of chromosome 1 was examined with a panel of 17 DNA clones mapping at bands 1q21–q23 (from centromere to telomere: RP11-97A5, RP11-235D19, RP11-68I18, RP11-98D18, RP1192M2, RP11-182L11, RP11-128L15, RP11-49N14, RP11-354A16, RP11-216N14, RP11-759F5, RP11-422P24, RP11-144B19, RP11205M9, RP11-350G8, RP11-274N19, RP11-107D16). The breakpoint fell within clone RP11-205M9, which gave three hybridization signals on normal chromosome 1, on der(1) and on der(5). All the other clones gave two hybridization signals: those more centromeric than RP11-205M9 on normal 1 and on der(1), and those more telomeric on normal 1 and on der(5). The RP11-205M9 clone mapping at the 1q21.2 band corresponds to a region that contains the following genes: C1orf43, the ubiquitin associated protein 2-like (UBAP2L) and tropomyosin 3 (TPM3). A TPM3/PDGFRB fusion transcript was amplified by seminested reverse transcriptase (RT)-PCR. Patient RNA was extracted with Trizol (Invitrogen, Carlsbad, CA, USA) from a bone marrow sample taken at diagnosis and retro-transcribed using the Thermoscript RT-PCR System (Invitrogen) (Figure 1a). The first round of amplification was performed with primers TPM3_425F (AGGTGGCTCGTAAGTTGGTG) and PDGFRB_2369R (TAGATGGGTCCTCCTTTGGTG) and the second with primers TPM3_425F and PDGFRBR1 (TAAG CATCTTGACGGCCACT). The product was cloned in pGEM-T Easy Vector System (Promega, Madison, WI, USA). Sequencing confirmed amplification of a chimeric transcript fusing exon 7 of TPM3 isoform 2 (GenBank accession no. NM_153649) with exon 11 of PDGFRB (Figure 1b). The reciprocal PDGFRB/ TPM3 fusion transcript was sought by RT-PCR using primers PDGFRB_1686F (CCGAACATCATCTGGTCTGC) and TPM3v2_1158R (GGATTCGATTGCTGCTTCAG), followed by nested PCR with primers PDGFRB-1810F (AGGAGCAG GAGTTTGAGGTG) and TPM3_919R (GGTGGTGAAAGGA GAAAGCA). We detected and sequenced a PDGFRB/TPM3 fusion transcript joining exon 10 of PDGFRB to exon 8 of TPM3 (data not shown). So one case of imatinib mesylate-sensitive CEL with t(1;5)(q21;q33) is, for the first time, observed to produce TPM3/PDGFRB with its reciprocal PDGFRB/TPM3 fusion. TPM3 is an actin-binding protein whose muscle isoform mediates myosin–actin response to calcium ions in skeletal muscles and whose non-muscle isoform is found in cytoskeletal microfilaments. A heterozygous TPM3 germline mutation is associated with the autosomal dominant form of nemaline myopathy. When fused to tyrosine kinases, TPM3 participates with its 221 NH2-terminal amino acids (encoded by exons 1–7), which contain the coiled-coil dimerization domain. In anaplastic cell lymphomas and in inflammatory myofibroblastic tumors with t(1;2)(q25;p23), TPM3 gene rearranges with ALK (anaplastic cell lymphoma kinase). In colon carcinoma and in papillary thyroid carcinomas, TPM3 rearranges with the nearby neurotrophic tyrosine kinase, receptor, type 1 (NTRK1/1q23) gene. In 20% of human papillary thyroid carcinomas, the H4/ D10S170 gene, at 10q21, is partner of the receptor tyrosine kinase RET in the inv(10)(q11.2q21). Interestingly, the H4/ D10S170 gene is another partner of PDGFRB, in aCML with

Genetic profile of T-cell acute lymphoblastic leukemias with MYC translocations.

MYC translocations represent a genetic subtype of T-lineage acute lymphoblastic leukemia (T-ALL), which occurs at an incidence of ∼6%, assessed within a cohort of 196 T-ALL patients (64 adults and 132 children). The translocations were of 2 types; those rearranged with the T-cell receptor loci and those with other partners. MYC translocations were significantly associated with the TAL/LMO subtype of T-ALL (P = .018) and trisomies 6 (P < .001) and 7 (P < .001). Within the TAL/LMO subtype, gene expression profiling identified 148 differentially expressed genes between patients with and without MYC translocations; specifically, 77 were upregulated and 71 downregulated in those with MYC translocations. The poor prognostic marker, CD44, was among the upregulated genes. MYC translocations occurred as secondary abnormalities, present in subclones in one-half of the cases. Longitudinal studies indicated an association with induction failure and relapse.

Combined interphase fluorescence in situ hybridization elucidates the genetic heterogeneity of T-cell acute lymphoblastic leukemia in adults

Background Molecular lesions in T-cell acute lymphoblastic leukemias affect regulators of cell cycle, proliferation, differentiation, survival and apoptosis in multi-step pathogenic pathways. Full genetic characterization is needed to identify events concurring in the development of these leukemias. Design and Methods We designed a combined interphase fluorescence in situ hybridization strategy to study 25 oncogenes/tumor suppressor genes in T-cell acute lymphoblastic leukemias and applied it in 23 adult patients for whom immunophenotyping, karyotyping, molecular studies, and gene expression profiling data were available. The results were confirmed and integrated with those of multiplex-polymerase chain reaction analysis and gene expression profiling in another 129 adults with T-cell acute lymphoblastic leukemias. Results The combined hybridization was abnormal in 21/23 patients (91%), and revealed multiple genomic changes in 13 (56%). It found abnormalities known to be associated with T-cell acute lymphoblastic leukemias, i.e. CDKN2A-B/9p21 and GRIK2/6q16 deletions, TCR and TLX3 rearrangements, SIL-TAL1, CALM-AF10, MLL-translocations, del(17)(q12)/NF1 and other cryptic genomic imbalances, i.e. 9q34, 11p, 12p, and 17q11 duplication, del(5)(q35), del(7)(q34), del(9)(q34), del(12)(p13), and del(14)(q11). It revealed new cytogenetic mechanisms for TCRB-driven oncogene activation and C-MYB duplication. In two cases with cryptic del(9)(q34), fluorescence in situ hybridization and reverse transcriptase polymerase chain reaction detected the TAF_INUP214 fusion and gene expression profiling identified a signature characterized by HOXA and NUP214 upregulation and TAF_I, FNBP1, C9orf78, and USP20 down-regulation. Multiplex-polymerase chain reaction analysis and gene expression profiling of 129 further cases found five additional cases of TAF_I-NUP214-positive T-cell acute lymphoblastic leukemia. Conclusions Our combined interphase fluorescence in situ hybridization strategy greatly improved the detection of genetic abnormalities in adult T-cell acute lymphoblastic leukemias. It identified new tumor suppressor genes/oncogenes involved in leukemogenesis and highlighted concurrent involvement of genes. The estimated incidence of TAF_I-NUP214, a new recurrent fusion in adult T-cell acute lymphoblastic leukemias, was 4.6% (7/152).

Trisomy 6 is the hallmark of a dysplastic clone in bone marrow aplasia.

Clonal hematopoiesis with trisomy 6 as the sole karyotypic change was revealed by cytogenetics in two cases of aplastic anemia. In both patients, dyserythropoiesis was characterized by asynchrony of maturation between nucleus and cytoplasm, binucleated elements, and intercytoplasmic connections. In addition to conventional cytogenetics, the size of the trisomic clone was evaluated by fluorescence in situ hybridization on fixed cells at diagnosis and in the course of the disease by using an alpha-satellite centromeric probe for chromosome 6. Moreover, in situ hybridization on bone marrow smears showed that dysplastic erythrocytes as well as myeloid cells belonged to the trisomic clone. Trisomy 6 identifies a subgroup of hematologic disorders with bone marrow hypo-aplasia and dyserythropoiesis.

Comparative genomic hybridization identifies 17q11.2∼q12 duplication as an early event in cutaneous T-cell lymphomas

Mycosis fungoides (MF) and Sézary syndrome (SS) are primary cutaneous T-cell lymphomas (CTCL), a heterogeneous group of extranodal non-Hodgkin lymphomas. In the three cases of MF and four of SS studied, comparative genomic hybridization detected chromosomal imbalances in all SS cases and in one MF case. In all five abnormal cases, the long arm of chromosome 17 was completely or partially duplicated; in three of these five cases, it was the sole genomic event. Notably, a minimal common duplicated region at 17q11.2 approximately q12, corresponded to the mapping of HER2/neu and STAT family genes. The only recurrent loss involved chromosome 10, with deletion of the entire long arm in one case and deletion of band 10q23 in another. Sporadic imbalances included gains at chromosome arms 1q, 2q, 7p, 7q, and 12p. Genomic duplication at 17q11.2 approximately q12 emerged as a primary karyotypic abnormality common to both MF and SS, which suggests that this is an early clonal event.

Interstitial Insertion of AF10 into the ALL1 Gene in a Case of Infant Acute Lymphoblastic Leukemia

The ALL1 gene at 11q23 is a promiscuous gene participating in chromosomal abnormalities of acute leukemias with 1 of over 30 potential partner genes. Among these, the AF10 gene at band 10p12 has been recently cloned and characterized. Acute leukemias with the ALL1/AF10 chimeric gene frequently show heterogeneity in the breakpoints on 10p, as well as complex insertion (10;11) as a result of complex molecular mechanisms leading to the ALL1/AF10 fusion. In this context, we report the first description of an infant acute lymphoblastic leukemia with an interstitial insertion of the AF10 gene into the 11q23 band, resulting in the transcription of the ALL1/AF10 fusion product. Furthermore, we show how different diagnostic tools such as molecular, cytogenetic, and fluorescence in situ hybridization (FISH) analyses should be combined to resolve complex situations in the 11q23 setting.

NPM1 Deletion Is Associated with Gross Chromosomal Rearrangements in Leukemia

Background NPM1 gene at chromosome 5q35 is involved in recurrent translocations in leukemia and lymphoma. It also undergoes mutations in 60% of adult acute myeloid leukemia (AML) cases with normal karyotype. The incidence and significance of NPM1 deletion in human leukemia have not been elucidated. Methodology and Principal Findings Bone marrow samples from 145 patients with myelodysplastic syndromes (MDS) and AML were included in this study. Cytogenetically 43 cases had isolated 5q-, 84 cases had 5q- plus other changes and 18 cases had complex karyotype without 5q deletion. FISH and direct sequencing investigated the NPM1 gene. NPM1 deletion was an uncommon event in the “5q- syndrome” but occurred in over 40% of cases with high risk MDS/AML with complex karyotypes and 5q loss. It originated from large 5q chromosome deletions. Simultaneous exon 12 mutations were never found. NPM1 gene status was related to the pattern of complex cytogenetic aberrations. NPM1 haploinsufficiency was significantly associated with monosomies (p<0.001) and gross chromosomal rearrangements, i.e., markers, rings, and double minutes (p<0.001), while NPM1 disomy was associated with structural changes (p = 0.013). Interestingly, in complex karyotypes with 5q- TP53 deletion and/or mutations are not specifically associated with NPM1 deletion. Conclusions and Significance NPM1/5q35 deletion is a consistent event in MDS/AML with a 5q-/-5 in complex karyotypes. NPM1 deletion and NPM1 exon 12 mutations appear to be mutually exclusive and are associated with two distinct cytogenetic subsets of MDS and AML.