Barbara Crescenzi

Post-transplant Kaposi sarcoma originates from the seeding of donor-derived progenitors.

Kaposi sarcoma (KS) is a vascular tumor that can develop in recipients of solid tissue transplants as a result of either primary infection or reactivation of a gammaherpesvirus, the KS- associated herpesvirus, also known as human herpesvirus-8 (HHV-8). We studied whether HHV-8 and the elusive KS progenitor cells could be transmitted from the donor through the grafts. We used a variety of molecular, cytogenetic, immunohistochemical and immunofluorescence methods to show that the HHV-8–infected neoplastic cells in post-transplant KS from five of eight renal transplant patients harbored either genetic or antigenic markers of their matched donors. These data suggest the use of donor-derived HHV-8–specific T cells for the control of post-transplant KS.

NOTCH1 PEST domain mutation is an adverse prognostic factor in B‐CLL

Prosper, J.Y., Campbell, K., Sutherland, D.R., Metcalfe, P., Horsfall, W. & Ouwehand, W.H. (2002) A tyrosine703serine polymorphism of CD109 defines the Gov platelet alloantigens. Blood, 99, 1692– 1698. Smith, J.W., Hayward, C.P., Horsewood, P., Warkentin, T.E., Denomme, G.A. & Kelton, J.G. (1995) Characterization and localization of the Gova/b alloantigens to the glycosylphosphatidylinositol-anchored protein CDw109 on human platelets. Blood, 86, 2807–2814.

Chronic myeloid leukemia: a prospective comparison of interphase fluorescence in situ hybridization and chromosome banding analysis for the definition of complete cytogenetic response, a study of the GIMEMA CML WP

In chronic myeloid leukemia, different methods are available to monitor the response to therapy: chromosome banding analysis (CBA), interphase fluorescence in situ hybridization (I-FISH), and real-time quantitative polymerase chain reaction (RT-Q-PCR). The GIMEMA CML WP (Gruppo Italiano Malattie Ematologiche Adulto Chronic Myeloid Leukemia Working Party) has performed a prospective study to compare CBA and I-FISH for the definition of complete cytogenetic response (CCgR). Samples (n = 664) were evaluated simultaneously by CBA and I-FISH. Of 537 cases in CCgR, the number of positive nuclei by I-FISH was less than 1% in 444 cases (82.7%). Of 451 cases with less than 1% positive nuclei by I-FISH, 444 (98.4%) were classified as CCgR by CBA. The major molecular response rate was significantly greater in cases with I-FISH less than 1% than in those with I-FISH 1% to 5% (66.8% vs 51.6%, P < .001) and in cases with CCgR and I-FISH less than 1% than in cases with CCgR and I-FISH 1% to 5% (66.1% vs 49.4%, P = .004). I-FISH is more sensitive than CBA and can be used to monitor CCgR. With appropriate probes, the cutoff value of I-FISH may be established at 1%. These trials are registered at http://www.clinicaltrials.gov as NCT00514488 and NCT00510926.

Overexpression of sPRDM16 coupled with loss of p53 induces myeloid leukemias in mice.

Transgenic expression of the abnormal products of acute myeloid leukemia-associated (AML-associated) primary chromosomal translocations in hematopoietic stem/progenitor cells initiates leukemogenesis in mice, yet additional mutations are needed for leukemia development. We report here aberrant expression of PR domain containing 16 (PRDM16) in AML cells with either translocations of 1p36 or normal karyotype. These carried, respectively, relatively high prevalence of mutations in the TP53 tumor suppressor gene and in the nucleophosmin (NPM) gene, which regulates p53. Two protein isoforms are expressed from PRDM16, which differ in the presence or absence of the PR domain. Overexpression of the short isoform, sPRDM16, in mouse bone marrow induced AML with full penetrance, but only in the absence of p53. The mouse leukemias were characterized by multilineage cellular abnormalities and megakaryocyte dysplasia, a common feature of human AMLs with 1p36 translocations or NPM mutations. Overexpression of sPRDM16 increased the pool of HSCs in vivo, and in vitro blocked myeloid differentiation and prolonged progenitor life span. Loss of p53 augmented the effects of sPRDM16 on stem cell number and induced immortalization of progenitors. Thus, overexpression of sPRDM16 induces abnormal growth of stem cells and progenitors and cooperates with disruption of the p53 pathway in the induction of myeloid leukemia.

t (4 ; 11) (q21 ; p15) translocation involving NUP98 and RAP1GDS1 genes : Characterization of a new subset of T acute lymphoblastic leukaemia

Two cases of T acute lymphoblastic leukaemia (T‐ALL) with an identical t(4;11)(q21;p15) translocation were identified within a prospective study on the biological and clinical features of adult ALL patients enrolled into the therapeutic protocol ALL0496 of the GIMEMA Italian Group. In both cases, the molecular characterization showed an involvement of the NUP98 gene on 11p15 which rearranges with the RAP1GDS1 gene on 4q21. The morphological and immunological features of the leukaemic cells, as well as the clinical behaviour and response to induction therapy, were the same in both patients. Based on the available data, the t(4;11)(q21;p15) translocation involving the NUP98–RAP1GDS1 fusion gene emerges as a new highly specific genetic abnormality that characterizes a subset of T‐ALL.

Human homeobox gene HOXC13 is the partner of NUP98 in adult acute myeloid leukemia with t(11;12)(p15;q13)

The chimeric gene NUP98/HOXC13 was detected in a patient with a de novo acute myeloid leukemia and a t(11;12)(p15;q13). Fluorescence in situ hybridization with PAC1173K1 identified the breakpoint on 11p15, indicating that the NUP98 gene was involved in the translocation. At 12q13, the breakpoint fell within BAC 578A18, selected for the homeobox C (HOXC) cluster genes. RACE‐PCR showed that HOXC13 was the partner gene of NUP98. To date, HOXC13 is the eighth homeobox gene that, as the result of a reciprocal translocation, fuses with NUP98 in myeloid malignancies.

Shwachman syndrome as mutator phenotype responsible for myeloid dysplasia/neoplasia through karyotype instability and chromosomes 7 and 20 anomalies

An investigation of 14 patients with Shwachman syndrome (SS), using standard and molecular cytogenetic methods and molecular genetic techniques, showed that (1) the i(7)(q10) is not, or not always, an isochromosome but may arise from a more complex mechanism, retaining part of the short arm; (2) the i(7)(q10) has no preferential parental origin; (3) clonal chromosome changes, such as chromosome 7 anomalies and del(20)(q11), may be present in the bone marrow (BM) for a long time without progressing to myelodysplastic syndrome (MDS)/acute myeloid leukemia (AML); (4) the del(20)(q11) involves the minimal region of deletion typical of MDS/AML; (5) the rate of chromosome breaks is not significantly higher than in controls, from which it is concluded that SS should not be considered a breakage syndrome; (6) a specific kind of karyotype instability is present in SS, with chromosome changes possibly found in single cells or small clones, often affecting chromosomes 7 and 20, in the BM. Hence, we have confirmed our previous hypothesis that the SS mutation itself implies a mutator effect that is responsible for MDS/AML through these specific chromosome anomalies. This conclusion supports the practice of including cytogenetic monitoring in the follow‐up of SS patients.

TPM3/PDGFRB fusion transcript and its reciprocal in chronic eosinophilic leukemia.

Using metaphase fluorescence in situ hybridization (FISH) to narrow translocation breakpoints and polymerase chain reaction (PCR) to identify genes, we detected the TPM3 gene at 1q21 as a new PDGFRB partner in chronic eosinophilic leukemia (CEL). CEL is defined by a persistent eosinophil count X1.5 10/l with no known underlying causes, organ involvement, evidence of eosinophil clonality or increased blasts. In 30–40% of patients with male predominance and high incidence of hepatomegaly and splenomegaly, CEL is associated with del(4)(q12)/FIP1L1-PDGFRA genomic change. Rare cases show 5q31–q33 rearrangements, in a few of which PDGFRB is involved. Interestingly, a t(1;5)(q21;q33) disrupting PDGFRB has been reported in one case classified as atypical chronic myeloid leukemia (aCML)/CEL. In 1991, a 21-year-old man with CEL showed a 46,XY, t(1;5)(q21;q33) karyotype in 28/29 metaphases. Under a-interferon treatment, which was administered for 10 years, the patient obtained a major cytogenetic response. In April 2002, imatinib therapy provided hematological, cytogenetic and FISH remission, which was maintained until the last checkup in January 2005. Metaphase FISH was performed using a bone marrow sample taken at diagnosis. Cosmid 9-4 for the 30 PDGFRB (green) and cosmid 4-1 for the 50 PDGFRB (red) gave a red/green fusion signal on normal 5, a green signal on der(5) and a red signal on der(1) indicating PDGFRB was rearranged. The long arm of chromosome 1 was examined with a panel of 17 DNA clones mapping at bands 1q21–q23 (from centromere to telomere: RP11-97A5, RP11-235D19, RP11-68I18, RP11-98D18, RP1192M2, RP11-182L11, RP11-128L15, RP11-49N14, RP11-354A16, RP11-216N14, RP11-759F5, RP11-422P24, RP11-144B19, RP11205M9, RP11-350G8, RP11-274N19, RP11-107D16). The breakpoint fell within clone RP11-205M9, which gave three hybridization signals on normal chromosome 1, on der(1) and on der(5). All the other clones gave two hybridization signals: those more centromeric than RP11-205M9 on normal 1 and on der(1), and those more telomeric on normal 1 and on der(5). The RP11-205M9 clone mapping at the 1q21.2 band corresponds to a region that contains the following genes: C1orf43, the ubiquitin associated protein 2-like (UBAP2L) and tropomyosin 3 (TPM3). A TPM3/PDGFRB fusion transcript was amplified by seminested reverse transcriptase (RT)-PCR. Patient RNA was extracted with Trizol (Invitrogen, Carlsbad, CA, USA) from a bone marrow sample taken at diagnosis and retro-transcribed using the Thermoscript RT-PCR System (Invitrogen) (Figure 1a). The first round of amplification was performed with primers TPM3_425F (AGGTGGCTCGTAAGTTGGTG) and PDGFRB_2369R (TAGATGGGTCCTCCTTTGGTG) and the second with primers TPM3_425F and PDGFRBR1 (TAAG CATCTTGACGGCCACT). The product was cloned in pGEM-T Easy Vector System (Promega, Madison, WI, USA). Sequencing confirmed amplification of a chimeric transcript fusing exon 7 of TPM3 isoform 2 (GenBank accession no. NM_153649) with exon 11 of PDGFRB (Figure 1b). The reciprocal PDGFRB/ TPM3 fusion transcript was sought by RT-PCR using primers PDGFRB_1686F (CCGAACATCATCTGGTCTGC) and TPM3v2_1158R (GGATTCGATTGCTGCTTCAG), followed by nested PCR with primers PDGFRB-1810F (AGGAGCAG GAGTTTGAGGTG) and TPM3_919R (GGTGGTGAAAGGA GAAAGCA). We detected and sequenced a PDGFRB/TPM3 fusion transcript joining exon 10 of PDGFRB to exon 8 of TPM3 (data not shown). So one case of imatinib mesylate-sensitive CEL with t(1;5)(q21;q33) is, for the first time, observed to produce TPM3/PDGFRB with its reciprocal PDGFRB/TPM3 fusion. TPM3 is an actin-binding protein whose muscle isoform mediates myosin–actin response to calcium ions in skeletal muscles and whose non-muscle isoform is found in cytoskeletal microfilaments. A heterozygous TPM3 germline mutation is associated with the autosomal dominant form of nemaline myopathy. When fused to tyrosine kinases, TPM3 participates with its 221 NH2-terminal amino acids (encoded by exons 1–7), which contain the coiled-coil dimerization domain. In anaplastic cell lymphomas and in inflammatory myofibroblastic tumors with t(1;2)(q25;p23), TPM3 gene rearranges with ALK (anaplastic cell lymphoma kinase). In colon carcinoma and in papillary thyroid carcinomas, TPM3 rearranges with the nearby neurotrophic tyrosine kinase, receptor, type 1 (NTRK1/1q23) gene. In 20% of human papillary thyroid carcinomas, the H4/ D10S170 gene, at 10q21, is partner of the receptor tyrosine kinase RET in the inv(10)(q11.2q21). Interestingly, the H4/ D10S170 gene is another partner of PDGFRB, in aCML with

Combined interphase fluorescence in situ hybridization elucidates the genetic heterogeneity of T-cell acute lymphoblastic leukemia in adults

Background Molecular lesions in T-cell acute lymphoblastic leukemias affect regulators of cell cycle, proliferation, differentiation, survival and apoptosis in multi-step pathogenic pathways. Full genetic characterization is needed to identify events concurring in the development of these leukemias. Design and Methods We designed a combined interphase fluorescence in situ hybridization strategy to study 25 oncogenes/tumor suppressor genes in T-cell acute lymphoblastic leukemias and applied it in 23 adult patients for whom immunophenotyping, karyotyping, molecular studies, and gene expression profiling data were available. The results were confirmed and integrated with those of multiplex-polymerase chain reaction analysis and gene expression profiling in another 129 adults with T-cell acute lymphoblastic leukemias. Results The combined hybridization was abnormal in 21/23 patients (91%), and revealed multiple genomic changes in 13 (56%). It found abnormalities known to be associated with T-cell acute lymphoblastic leukemias, i.e. CDKN2A-B/9p21 and GRIK2/6q16 deletions, TCR and TLX3 rearrangements, SIL-TAL1, CALM-AF10, MLL-translocations, del(17)(q12)/NF1 and other cryptic genomic imbalances, i.e. 9q34, 11p, 12p, and 17q11 duplication, del(5)(q35), del(7)(q34), del(9)(q34), del(12)(p13), and del(14)(q11). It revealed new cytogenetic mechanisms for TCRB-driven oncogene activation and C-MYB duplication. In two cases with cryptic del(9)(q34), fluorescence in situ hybridization and reverse transcriptase polymerase chain reaction detected the TAF_INUP214 fusion and gene expression profiling identified a signature characterized by HOXA and NUP214 upregulation and TAF_I, FNBP1, C9orf78, and USP20 down-regulation. Multiplex-polymerase chain reaction analysis and gene expression profiling of 129 further cases found five additional cases of TAF_I-NUP214-positive T-cell acute lymphoblastic leukemia. Conclusions Our combined interphase fluorescence in situ hybridization strategy greatly improved the detection of genetic abnormalities in adult T-cell acute lymphoblastic leukemias. It identified new tumor suppressor genes/oncogenes involved in leukemogenesis and highlighted concurrent involvement of genes. The estimated incidence of TAF_I-NUP214, a new recurrent fusion in adult T-cell acute lymphoblastic leukemias, was 4.6% (7/152).

CIZ gene rearrangements in acute leukemia: report of a diagnostic FISH assay and clinical features of nine patients

CIZ gene rearrangements in acute leukemia: report of a diagnostic FISH assay and clinical features of nine patients