Paolo Gorello

Quantitative assessment of minimal residual disease in acute myeloid leukemia carrying nucleophosmin (NPM1) gene mutations

Mutations in exon 12 of the nucleophosmin (NPM1) gene occur in about 60% of adult AML with normal karyotype. By exploiting a specific feature of NPM1 mutants, that is insertion at residue 956 or deletion/insertion at residue 960, we developed highly sensitive, real-time quantitative (RQ) polymerase chain reaction (PCR) assays, either in DNA or RNA, that are specific for various NPM1 mutations. In all 13 AML patients carrying NPM1 mutations at diagnosis, cDNA RQ-PCR showed >30 000 copies of NPM1-mutated transcript. A small or no decrease in copies was observed in three patients showing partial or no response to induction therapy. The number of NPM1-mutated copies was markedly reduced in 10 patients achieving complete hematological remission (five cases: <100 copies; five cases: 580–5046 copies). In four patients studied at different time intervals, the number of NPM1 copies closely correlated with clinical status and predicted impending hematological relapse in two. Thus, reliable, sensitive RQ-PCR assays for NPM1 mutations can now monitor and quantify MRD in AML patients with normal karyotype and NPM1 gene mutations.

Leukemogenic mechanisms and targets of a NUP98/HHEX fusion in acute myeloid leukemia

We have studied a patient with acute myeloid leukemia (AML) and t(10;11)(q23;p15) as the sole cytogenetic abnormality. Molecular analysis revealed a translocation involving nucleoporin 98 (NUP98) fused to the DNA-binding domain of the hematopoietically expressed homeobox gene (HHEX). Expression of NUP98/HHEX in murine bone marrow cells leads to aberrant self-renewal and a block in normal differentiation that depends on the integrity of the NUP98 GFLG repeats and the HHEX homeodomain. Transplantation of bone marrow cells expressing NUP98/HHEX leads to transplantable acute leukemia characterized by extensive infiltration of leukemic blasts expressing myeloid markers (Gr1(+)) as well as markers of the B-cell lineage (B220(+)). A latency period of 9 months and its clonal character suggest that NUP98/HHEX is necessary but not sufficient for disease induction. Expression of EGFP-NUP98/HHEX fusions showed a highly similar nuclear localization pattern as for other NUP98/homeodomain fusions, such as NUP98/HOXA9. Comparative gene expression profiling in primary bone marrow cells provided evidence for the presence of common targets in cells expressing NUP98/HOXA9 or NUP98/HHEX. Some of these genes (Hoxa5, Hoxa9, Flt3) are deregulated in NUP98/HHEX-induced murine leukemia as well as in human blasts carrying this fusion and might represent bona fide therapeutic targets.

Gene expression profiling identifies a subset of adult T-cell acute lymphoblastic leukemia with myeloid-like gene features and over-expression of miR-223

Background Until recently, few molecular aberrations were recognized in acute lymphoblastic leukemia of T-cell origin; novel lesions have recently been identified and a certain degree of overlap between acute myeloid leukemia and T-cell acute lymphoblastic leukemia has been suggested. To identify novel T-cell acute lymphoblastic leukemia entities, gene expression profiling was performed and clinico-biological features were studied. Design and Methods Sixty-nine untreated adults with T-cell acute lymphoblastic leukemia were evaluated by oligonucleotide arrays: unsupervised and supervised analyses were performed. The up-regulation of myeloid genes and miR-223 expression were validated by quantitative polymerase chain reaction analysis. Results Using unsupervised clustering, we identified five subgroups. Of these, one branch included seven patients whose gene expression profile resembled that of acute myeloid leukemia. These cases were characterized by over-expression of a large set of myeloid-related genes for surface antigens, transcription factors and granule proteins. Real-time quantitative polymerase chain reaction analysis confirmed over-expression of MPO, CEBPA, CEBPB, GRN and IL8. We, therefore, evaluated the expression levels of miR-223, involved in myeloid differentiation: these cases had significantly higher levels of miR-223 than had the other cases of T-cell acute lymphoblastic leukemia, with values comparable to those observed in acute myeloid leukemia. Finally, these patients appear to have an unfavorable clinical course. Conclusions Using gene profiling we identified a subset of adult T-cell acute lymphoblastic leukemia, accounting for 10% of the cases analyzed, which displays myeloid features. These cases were not recognized by standard approaches, underlining the importance of gene profiling in identifying novel acute leukemia subsets. The recognition of this subgroup may have clinical, prognostic and therapeutic implications.

Cryptic insertion producing two NUP98/NSD1 chimeric transcripts in adult refractory anemia with an excess of blasts

We performed cytogenetic and molecular studies on an adult patient with refractory anemia with an excess of blasts with an add(11)(p15). Multicolor fluorescence in situ hybridization (FISH) identified the extra material on 11p as belonging to chromosome 15. Metaphase FISH with probes for chromosomes 5, 11, and 15 revealed a complex four‐break rearrangement. Clone RP5‐1173K1, containing exons 10–20 of the NUP98 gene, gave three fluorescence signals on the normal 11, the der(5), and the der(15). 3′‐RACE‐PCR identified an in‐frame fusion between NUP98 and NSD1, which was confirmed by RT‐PCR. Two different spliced forms, that is, NUP98 exon 11/NSD1 exon 6 and NUP98 exon 12/NSD1 exon 6, were detected. The reciprocal NSD1/NUP98 was not found. A dual‐color experiment with RP5‐1173K1 and CTC‐549A4, spanning the entire NSD1 gene, indicated an insertion of NUP98 into the NSD1 locus. This is the first report of an adult with myelodysplastic syndrome (MDS) harboring an NUP98/NSD1 fusion resulting from insertion of 5′‐NUP98 into the NSD1/5q35 locus.

TPM3/PDGFRB fusion transcript and its reciprocal in chronic eosinophilic leukemia.

Using metaphase fluorescence in situ hybridization (FISH) to narrow translocation breakpoints and polymerase chain reaction (PCR) to identify genes, we detected the TPM3 gene at 1q21 as a new PDGFRB partner in chronic eosinophilic leukemia (CEL). CEL is defined by a persistent eosinophil count X1.5 10/l with no known underlying causes, organ involvement, evidence of eosinophil clonality or increased blasts. In 30–40% of patients with male predominance and high incidence of hepatomegaly and splenomegaly, CEL is associated with del(4)(q12)/FIP1L1-PDGFRA genomic change. Rare cases show 5q31–q33 rearrangements, in a few of which PDGFRB is involved. Interestingly, a t(1;5)(q21;q33) disrupting PDGFRB has been reported in one case classified as atypical chronic myeloid leukemia (aCML)/CEL. In 1991, a 21-year-old man with CEL showed a 46,XY, t(1;5)(q21;q33) karyotype in 28/29 metaphases. Under a-interferon treatment, which was administered for 10 years, the patient obtained a major cytogenetic response. In April 2002, imatinib therapy provided hematological, cytogenetic and FISH remission, which was maintained until the last checkup in January 2005. Metaphase FISH was performed using a bone marrow sample taken at diagnosis. Cosmid 9-4 for the 30 PDGFRB (green) and cosmid 4-1 for the 50 PDGFRB (red) gave a red/green fusion signal on normal 5, a green signal on der(5) and a red signal on der(1) indicating PDGFRB was rearranged. The long arm of chromosome 1 was examined with a panel of 17 DNA clones mapping at bands 1q21–q23 (from centromere to telomere: RP11-97A5, RP11-235D19, RP11-68I18, RP11-98D18, RP1192M2, RP11-182L11, RP11-128L15, RP11-49N14, RP11-354A16, RP11-216N14, RP11-759F5, RP11-422P24, RP11-144B19, RP11205M9, RP11-350G8, RP11-274N19, RP11-107D16). The breakpoint fell within clone RP11-205M9, which gave three hybridization signals on normal chromosome 1, on der(1) and on der(5). All the other clones gave two hybridization signals: those more centromeric than RP11-205M9 on normal 1 and on der(1), and those more telomeric on normal 1 and on der(5). The RP11-205M9 clone mapping at the 1q21.2 band corresponds to a region that contains the following genes: C1orf43, the ubiquitin associated protein 2-like (UBAP2L) and tropomyosin 3 (TPM3). A TPM3/PDGFRB fusion transcript was amplified by seminested reverse transcriptase (RT)-PCR. Patient RNA was extracted with Trizol (Invitrogen, Carlsbad, CA, USA) from a bone marrow sample taken at diagnosis and retro-transcribed using the Thermoscript RT-PCR System (Invitrogen) (Figure 1a). The first round of amplification was performed with primers TPM3_425F (AGGTGGCTCGTAAGTTGGTG) and PDGFRB_2369R (TAGATGGGTCCTCCTTTGGTG) and the second with primers TPM3_425F and PDGFRBR1 (TAAG CATCTTGACGGCCACT). The product was cloned in pGEM-T Easy Vector System (Promega, Madison, WI, USA). Sequencing confirmed amplification of a chimeric transcript fusing exon 7 of TPM3 isoform 2 (GenBank accession no. NM_153649) with exon 11 of PDGFRB (Figure 1b). The reciprocal PDGFRB/ TPM3 fusion transcript was sought by RT-PCR using primers PDGFRB_1686F (CCGAACATCATCTGGTCTGC) and TPM3v2_1158R (GGATTCGATTGCTGCTTCAG), followed by nested PCR with primers PDGFRB-1810F (AGGAGCAG GAGTTTGAGGTG) and TPM3_919R (GGTGGTGAAAGGA GAAAGCA). We detected and sequenced a PDGFRB/TPM3 fusion transcript joining exon 10 of PDGFRB to exon 8 of TPM3 (data not shown). So one case of imatinib mesylate-sensitive CEL with t(1;5)(q21;q33) is, for the first time, observed to produce TPM3/PDGFRB with its reciprocal PDGFRB/TPM3 fusion. TPM3 is an actin-binding protein whose muscle isoform mediates myosin–actin response to calcium ions in skeletal muscles and whose non-muscle isoform is found in cytoskeletal microfilaments. A heterozygous TPM3 germline mutation is associated with the autosomal dominant form of nemaline myopathy. When fused to tyrosine kinases, TPM3 participates with its 221 NH2-terminal amino acids (encoded by exons 1–7), which contain the coiled-coil dimerization domain. In anaplastic cell lymphomas and in inflammatory myofibroblastic tumors with t(1;2)(q25;p23), TPM3 gene rearranges with ALK (anaplastic cell lymphoma kinase). In colon carcinoma and in papillary thyroid carcinomas, TPM3 rearranges with the nearby neurotrophic tyrosine kinase, receptor, type 1 (NTRK1/1q23) gene. In 20% of human papillary thyroid carcinomas, the H4/ D10S170 gene, at 10q21, is partner of the receptor tyrosine kinase RET in the inv(10)(q11.2q21). Interestingly, the H4/ D10S170 gene is another partner of PDGFRB, in aCML with

Combined interphase fluorescence in situ hybridization elucidates the genetic heterogeneity of T-cell acute lymphoblastic leukemia in adults

Background Molecular lesions in T-cell acute lymphoblastic leukemias affect regulators of cell cycle, proliferation, differentiation, survival and apoptosis in multi-step pathogenic pathways. Full genetic characterization is needed to identify events concurring in the development of these leukemias. Design and Methods We designed a combined interphase fluorescence in situ hybridization strategy to study 25 oncogenes/tumor suppressor genes in T-cell acute lymphoblastic leukemias and applied it in 23 adult patients for whom immunophenotyping, karyotyping, molecular studies, and gene expression profiling data were available. The results were confirmed and integrated with those of multiplex-polymerase chain reaction analysis and gene expression profiling in another 129 adults with T-cell acute lymphoblastic leukemias. Results The combined hybridization was abnormal in 21/23 patients (91%), and revealed multiple genomic changes in 13 (56%). It found abnormalities known to be associated with T-cell acute lymphoblastic leukemias, i.e. CDKN2A-B/9p21 and GRIK2/6q16 deletions, TCR and TLX3 rearrangements, SIL-TAL1, CALM-AF10, MLL-translocations, del(17)(q12)/NF1 and other cryptic genomic imbalances, i.e. 9q34, 11p, 12p, and 17q11 duplication, del(5)(q35), del(7)(q34), del(9)(q34), del(12)(p13), and del(14)(q11). It revealed new cytogenetic mechanisms for TCRB-driven oncogene activation and C-MYB duplication. In two cases with cryptic del(9)(q34), fluorescence in situ hybridization and reverse transcriptase polymerase chain reaction detected the TAF_INUP214 fusion and gene expression profiling identified a signature characterized by HOXA and NUP214 upregulation and TAF_I, FNBP1, C9orf78, and USP20 down-regulation. Multiplex-polymerase chain reaction analysis and gene expression profiling of 129 further cases found five additional cases of TAF_I-NUP214-positive T-cell acute lymphoblastic leukemia. Conclusions Our combined interphase fluorescence in situ hybridization strategy greatly improved the detection of genetic abnormalities in adult T-cell acute lymphoblastic leukemias. It identified new tumor suppressor genes/oncogenes involved in leukemogenesis and highlighted concurrent involvement of genes. The estimated incidence of TAF_I-NUP214, a new recurrent fusion in adult T-cell acute lymphoblastic leukemias, was 4.6% (7/152).

CIZ gene rearrangements in acute leukemia: report of a diagnostic FISH assay and clinical features of nine patients

CIZ gene rearrangements in acute leukemia: report of a diagnostic FISH assay and clinical features of nine patients

NUP98 fusion oncoproteins promote aneuploidy by attenuating the mitotic spindle checkpoint.

NUP98 is a recurrent fusion partner in chromosome translocations that cause acute myelogenous leukemia. NUP98, a nucleoporin, and its interaction partner Rae1, have been implicated in the control of chromosome segregation, but their mechanistic contributions to tumorigenesis have been unclear. Here, we show that expression of NUP98 fusion oncoproteins causes mitotic spindle defects and chromosome missegregation, correlating with the capability of NUP98 fusions to cause premature securin degradation and slippage from an unsatisfied spindle assembly checkpoint (SAC). NUP98 fusions, unlike wild-type NUP98, were found to physically interact with the anaphase promoting complex/cyclosome (APC/C)(Cdc20) and to displace the BubR1 SAC component, suggesting a possible mechanistic basis for their interference with SAC function. In addition, NUP98 oncoproteins displayed a prolonged half-life in cells. We found that NUP98 stability is controlled by a PEST sequence, absent in NUP98 oncoproteins, whose deletion reproduced the aberrant SAC-interfering activity of NUP98 oncoproteins. Together, our findings suggest that NUP98 oncoproteins predispose myeloid cells to oncogenic transformation or malignant progression by promoting whole chromosome instability.

Functional Cross Talk between CXCR4 and PDGFR on Glioblastoma Cells Is Essential for Migration

Glioblastoma (GBM) is the most common and aggressive form of brain tumor, characterized by high migratory behavior and infiltration in brain parenchyma which render classic therapeutic approach ineffective. The migratory behaviour of GBM cells could be conditioned by a number of tissue- and glioma-derived cytokines and growth factors. Although the pro-migratory action of CXCL12 on GBM cells in vitro and in vivo is recognized, the molecular mechanisms involved are not clearly identified. In fact the signaling pathways involved in the pro-migratory action of CXCL12 may differ in individual glioblastoma and integrate with those resulting from abnormal expression and activation of growth factor receptors. In this study we investigated whether some of the receptor tyrosine kinases commonly expressed in GBM cells could cooperate with CXCL12/CXCR4 in their migratory behavior. Our results show a functional cross-talk between CXCR4 and PDGFR which appears to be essential for GBM chemotaxis.

A new NDE1/PDGFRB fusion transcript underlying chronic myelomonocytic leukaemia in Noonan Syndrome.

A new NDE1/PDGFRB fusion transcript underlying chronic myelomonocytic leukaemia in Noonan Syndrome