Valentina Pierini

Efficacy of Non-Pharmacological Interventions to Prevent and Treat Delirium in Older Patients: A Systematic Overview. The SENATOR project ONTOP Series

Background Non-pharmacological intervention (e.g. multidisciplinary interventions, music therapy, bright light therapy, educational interventions etc.) are alternative interventions that can be used in older subjects. There are plenty reviews of non-pharmacological interventions for the prevention and treatment of delirium in older patients and clinicians need a synthesized, methodologically sound document for their decision making. Methods and Findings We performed a systematic overview of systematic reviews (SRs) of comparative studies concerning non-pharmacological intervention to treat or prevent delirium in older patients. The PubMed, Cochrane Database of Systematic Reviews, EMBASE, CINHAL, and PsychINFO (April 28th, 2014) were searched for relevant articles. AMSTAR was used to assess the quality of the SRs. The GRADE approach was used to assess the quality of primary studies. The elements of the multicomponent interventions were identified and compared among different studies to explore the possibility of performing a meta-analysis. Risk ratios were estimated using a random-effects model. Twenty-four SRs with 31 primary studies satisfied the inclusion criteria. Based on the AMSTAR criteria twelve reviews resulted of moderate quality and three resulted of high quality. Overall, multicomponent non-pharmacological interventions significantly reduced the incidence of delirium in surgical wards [2 randomized trials (RCTs): relative risk (RR) 0.71, 95% Confidence Interval (CI) 0.59 to 0.86, I2=0%; (GRADE evidence: moderate)] and in medical wards [2 CCTs: RR 0.65, 95%CI 0.49 to 0.86, I2=0%; (GRADE evidence: moderate)]. There is no evidence supporting the efficacy of non-pharmacological interventions to prevent delirium in low risk populations (i.e. low rate of delirium in the control group)[1 RCT: RR 1.75, 95%CI 0.50 to 6.10 (GRADE evidence: very low)]. For patients who have developed delirium, the available evidence does not support the efficacy of multicomponent non-pharmacological interventions to treat delirium. Among single component interventions only staff education, reorientation protocol (GRADE evidence: very low)] and Geriatric Risk Assessment MedGuide software [hazard ratio 0.42, 95%CI 0.35 to 0.52, (GRADE evidence: moderate)] resulted effective in preventing delirium. Conclusions In older patients multi-component non-pharmacological interventions as well as some single-components intervention were effective in preventing delirium but not to treat delirium.

TPM3/PDGFRB fusion transcript and its reciprocal in chronic eosinophilic leukemia.

Using metaphase fluorescence in situ hybridization (FISH) to narrow translocation breakpoints and polymerase chain reaction (PCR) to identify genes, we detected the TPM3 gene at 1q21 as a new PDGFRB partner in chronic eosinophilic leukemia (CEL). CEL is defined by a persistent eosinophil count X1.5 10/l with no known underlying causes, organ involvement, evidence of eosinophil clonality or increased blasts. In 30–40% of patients with male predominance and high incidence of hepatomegaly and splenomegaly, CEL is associated with del(4)(q12)/FIP1L1-PDGFRA genomic change. Rare cases show 5q31–q33 rearrangements, in a few of which PDGFRB is involved. Interestingly, a t(1;5)(q21;q33) disrupting PDGFRB has been reported in one case classified as atypical chronic myeloid leukemia (aCML)/CEL. In 1991, a 21-year-old man with CEL showed a 46,XY, t(1;5)(q21;q33) karyotype in 28/29 metaphases. Under a-interferon treatment, which was administered for 10 years, the patient obtained a major cytogenetic response. In April 2002, imatinib therapy provided hematological, cytogenetic and FISH remission, which was maintained until the last checkup in January 2005. Metaphase FISH was performed using a bone marrow sample taken at diagnosis. Cosmid 9-4 for the 30 PDGFRB (green) and cosmid 4-1 for the 50 PDGFRB (red) gave a red/green fusion signal on normal 5, a green signal on der(5) and a red signal on der(1) indicating PDGFRB was rearranged. The long arm of chromosome 1 was examined with a panel of 17 DNA clones mapping at bands 1q21–q23 (from centromere to telomere: RP11-97A5, RP11-235D19, RP11-68I18, RP11-98D18, RP1192M2, RP11-182L11, RP11-128L15, RP11-49N14, RP11-354A16, RP11-216N14, RP11-759F5, RP11-422P24, RP11-144B19, RP11205M9, RP11-350G8, RP11-274N19, RP11-107D16). The breakpoint fell within clone RP11-205M9, which gave three hybridization signals on normal chromosome 1, on der(1) and on der(5). All the other clones gave two hybridization signals: those more centromeric than RP11-205M9 on normal 1 and on der(1), and those more telomeric on normal 1 and on der(5). The RP11-205M9 clone mapping at the 1q21.2 band corresponds to a region that contains the following genes: C1orf43, the ubiquitin associated protein 2-like (UBAP2L) and tropomyosin 3 (TPM3). A TPM3/PDGFRB fusion transcript was amplified by seminested reverse transcriptase (RT)-PCR. Patient RNA was extracted with Trizol (Invitrogen, Carlsbad, CA, USA) from a bone marrow sample taken at diagnosis and retro-transcribed using the Thermoscript RT-PCR System (Invitrogen) (Figure 1a). The first round of amplification was performed with primers TPM3_425F (AGGTGGCTCGTAAGTTGGTG) and PDGFRB_2369R (TAGATGGGTCCTCCTTTGGTG) and the second with primers TPM3_425F and PDGFRBR1 (TAAG CATCTTGACGGCCACT). The product was cloned in pGEM-T Easy Vector System (Promega, Madison, WI, USA). Sequencing confirmed amplification of a chimeric transcript fusing exon 7 of TPM3 isoform 2 (GenBank accession no. NM_153649) with exon 11 of PDGFRB (Figure 1b). The reciprocal PDGFRB/ TPM3 fusion transcript was sought by RT-PCR using primers PDGFRB_1686F (CCGAACATCATCTGGTCTGC) and TPM3v2_1158R (GGATTCGATTGCTGCTTCAG), followed by nested PCR with primers PDGFRB-1810F (AGGAGCAG GAGTTTGAGGTG) and TPM3_919R (GGTGGTGAAAGGA GAAAGCA). We detected and sequenced a PDGFRB/TPM3 fusion transcript joining exon 10 of PDGFRB to exon 8 of TPM3 (data not shown). So one case of imatinib mesylate-sensitive CEL with t(1;5)(q21;q33) is, for the first time, observed to produce TPM3/PDGFRB with its reciprocal PDGFRB/TPM3 fusion. TPM3 is an actin-binding protein whose muscle isoform mediates myosin–actin response to calcium ions in skeletal muscles and whose non-muscle isoform is found in cytoskeletal microfilaments. A heterozygous TPM3 germline mutation is associated with the autosomal dominant form of nemaline myopathy. When fused to tyrosine kinases, TPM3 participates with its 221 NH2-terminal amino acids (encoded by exons 1–7), which contain the coiled-coil dimerization domain. In anaplastic cell lymphomas and in inflammatory myofibroblastic tumors with t(1;2)(q25;p23), TPM3 gene rearranges with ALK (anaplastic cell lymphoma kinase). In colon carcinoma and in papillary thyroid carcinomas, TPM3 rearranges with the nearby neurotrophic tyrosine kinase, receptor, type 1 (NTRK1/1q23) gene. In 20% of human papillary thyroid carcinomas, the H4/ D10S170 gene, at 10q21, is partner of the receptor tyrosine kinase RET in the inv(10)(q11.2q21). Interestingly, the H4/ D10S170 gene is another partner of PDGFRB, in aCML with

Genetic profile of T-cell acute lymphoblastic leukemias with MYC translocations.

MYC translocations represent a genetic subtype of T-lineage acute lymphoblastic leukemia (T-ALL), which occurs at an incidence of ∼6%, assessed within a cohort of 196 T-ALL patients (64 adults and 132 children). The translocations were of 2 types; those rearranged with the T-cell receptor loci and those with other partners. MYC translocations were significantly associated with the TAL/LMO subtype of T-ALL (P = .018) and trisomies 6 (P < .001) and 7 (P < .001). Within the TAL/LMO subtype, gene expression profiling identified 148 differentially expressed genes between patients with and without MYC translocations; specifically, 77 were upregulated and 71 downregulated in those with MYC translocations. The poor prognostic marker, CD44, was among the upregulated genes. MYC translocations occurred as secondary abnormalities, present in subclones in one-half of the cases. Longitudinal studies indicated an association with induction failure and relapse.

Combined interphase fluorescence in situ hybridization elucidates the genetic heterogeneity of T-cell acute lymphoblastic leukemia in adults

Background Molecular lesions in T-cell acute lymphoblastic leukemias affect regulators of cell cycle, proliferation, differentiation, survival and apoptosis in multi-step pathogenic pathways. Full genetic characterization is needed to identify events concurring in the development of these leukemias. Design and Methods We designed a combined interphase fluorescence in situ hybridization strategy to study 25 oncogenes/tumor suppressor genes in T-cell acute lymphoblastic leukemias and applied it in 23 adult patients for whom immunophenotyping, karyotyping, molecular studies, and gene expression profiling data were available. The results were confirmed and integrated with those of multiplex-polymerase chain reaction analysis and gene expression profiling in another 129 adults with T-cell acute lymphoblastic leukemias. Results The combined hybridization was abnormal in 21/23 patients (91%), and revealed multiple genomic changes in 13 (56%). It found abnormalities known to be associated with T-cell acute lymphoblastic leukemias, i.e. CDKN2A-B/9p21 and GRIK2/6q16 deletions, TCR and TLX3 rearrangements, SIL-TAL1, CALM-AF10, MLL-translocations, del(17)(q12)/NF1 and other cryptic genomic imbalances, i.e. 9q34, 11p, 12p, and 17q11 duplication, del(5)(q35), del(7)(q34), del(9)(q34), del(12)(p13), and del(14)(q11). It revealed new cytogenetic mechanisms for TCRB-driven oncogene activation and C-MYB duplication. In two cases with cryptic del(9)(q34), fluorescence in situ hybridization and reverse transcriptase polymerase chain reaction detected the TAF_INUP214 fusion and gene expression profiling identified a signature characterized by HOXA and NUP214 upregulation and TAF_I, FNBP1, C9orf78, and USP20 down-regulation. Multiplex-polymerase chain reaction analysis and gene expression profiling of 129 further cases found five additional cases of TAF_I-NUP214-positive T-cell acute lymphoblastic leukemia. Conclusions Our combined interphase fluorescence in situ hybridization strategy greatly improved the detection of genetic abnormalities in adult T-cell acute lymphoblastic leukemias. It identified new tumor suppressor genes/oncogenes involved in leukemogenesis and highlighted concurrent involvement of genes. The estimated incidence of TAF_I-NUP214, a new recurrent fusion in adult T-cell acute lymphoblastic leukemias, was 4.6% (7/152).

A new NDE1/PDGFRB fusion transcript underlying chronic myelomonocytic leukaemia in Noonan Syndrome.

A new NDE1/PDGFRB fusion transcript underlying chronic myelomonocytic leukaemia in Noonan Syndrome

New MLLT10 gene recombinations in pediatric T-acute lymphoblastic leukemia

The MLLT10 gene, located at 10p13, is a known partner of MLL and PICALM in specific leukemic fusions generated from recurrent 11q23 and 11q14 chromosome translocations. Deep sequencing recently identified NAP1L1/12q21 as another MLLT10 partner in T-cell acute lymphoblastic leukemia (T-ALL). In pediatric T-ALL, we have identified 2 RNA processing genes, that is, HNRNPH1/5q35 and DDX3X/Xp11.3 as new MLLT10 fusion partners. Gene expression profile signatures of the HNRNPH1- and DDX3X-MLLT10 fusions placed them in the HOXA subgroup. Remarkably, they were highly similar only to PICALM-MLLT10-positive cases. The present study showed MLLT10 promiscuity in pediatric T-ALL and identified a specific MLLT10 signature within the HOXA subgroup.

t(3;11)(q12;p15)/NUP98-LOC348801 fusion transcript in acute myeloid leukemia

This paper describes molecular cytogenetic findings of a t(3;11)(q12;p15), characterized as a new NUP98 translocation rearranging with LOC348801 at chromosome 3, in a patient with acute myeloid leukemia. In a case of acute myeloid leukemia we report molecular cytogenetic findings of a t(3;11)(q12;p15), characterized as a new NUP98 translocation rearranging with LOC348801 at chromosome 3. NUP98 involvement was detected by fluorescence in situ hybridization. 3’-RACE-PCR showed nucleotide 1718 (exon 13) of NUP98 was fused in-frame with nucleotide 1248 (exon 2) of LOC348801. RT-PCR and cloning experiments detected two in-frame spliced NUP98-LOC348801 transcripts and the reciprocal LOC348801-NUP98. A highly specific double-color double-fusion FISH assay reliably detects NUP98-LOC348801.

NPM1 Deletion Is Associated with Gross Chromosomal Rearrangements in Leukemia

Background NPM1 gene at chromosome 5q35 is involved in recurrent translocations in leukemia and lymphoma. It also undergoes mutations in 60% of adult acute myeloid leukemia (AML) cases with normal karyotype. The incidence and significance of NPM1 deletion in human leukemia have not been elucidated. Methodology and Principal Findings Bone marrow samples from 145 patients with myelodysplastic syndromes (MDS) and AML were included in this study. Cytogenetically 43 cases had isolated 5q-, 84 cases had 5q- plus other changes and 18 cases had complex karyotype without 5q deletion. FISH and direct sequencing investigated the NPM1 gene. NPM1 deletion was an uncommon event in the “5q- syndrome” but occurred in over 40% of cases with high risk MDS/AML with complex karyotypes and 5q loss. It originated from large 5q chromosome deletions. Simultaneous exon 12 mutations were never found. NPM1 gene status was related to the pattern of complex cytogenetic aberrations. NPM1 haploinsufficiency was significantly associated with monosomies (p<0.001) and gross chromosomal rearrangements, i.e., markers, rings, and double minutes (p<0.001), while NPM1 disomy was associated with structural changes (p = 0.013). Interestingly, in complex karyotypes with 5q- TP53 deletion and/or mutations are not specifically associated with NPM1 deletion. Conclusions and Significance NPM1/5q35 deletion is a consistent event in MDS/AML with a 5q-/-5 in complex karyotypes. NPM1 deletion and NPM1 exon 12 mutations appear to be mutually exclusive and are associated with two distinct cytogenetic subsets of MDS and AML.

A PDGFRB-positive acute myeloid malignancy with a new t(5;12)(q33;p13.3) involving the ERC1 gene.

A PDGFRB -positive acute myeloid malignancy with a new t(5;12)(q33;p13.3) involving the ERC1 gene

Non-pharmacological interventions to prevent or treat delirium in older patients: Clinical practice recommendations the SENATOR-ONTOP series

DescriptionThe ONTOP project aims to undertake a literature search of systematic reviews concerning evidence-based non-pharmacological interventions of prevalent medical conditions affecting older people, including delirium.ObjectivesTo develop explicit and transparent recommendations for nonpharmacological interventions in older subjects at risk of developing delirium, as well as in older subjects with delirium, based on the Grading of Recommendations, Assessment, Development and Evaluation (GRADE) approach to rating the quality of evidence and the strength of recommendations.MethodsA multidisciplinary panel was constituted comprising geriatricians, research nurse and a clinical epidemiologist. The panel developed a systematic overview of non-pharmacological interventions to prevent or treat delirium. The GRADE approach was used to rate the evidence and to formulate recommendations.ResultsThe critical outcomes were delirium incidence, for delirium prevention, and delirium improvement and functional status, for delirium treatment. The non-pharmacological interventions were identified and categorized as multicomponent and single component. Strong recommendations in favor of multicomponent interventions to prevent delirium, in surgical or medicals wards, were formulated. In the latter case the evidence applied to older patients at intermediate - high risk of developing delirium. Weak recommendations, to prevent delirium, were formulated for multicomponent interventions provided by family members (medical ward), staff education (medical ward), ear plugs (intensive care unit), reorientation protocol (intensive care unit), and the use of a software to perform drug review. Weak recommendations were provided for the use of multicomponent interventions to prevent delirium in medical wards in patients not selected according to the risk of delirium. Strong recommendations not to use bright light therapy to prevent delirium in intensive care unit settings were articulated. Weak recommendations not to use music therapy to prevent delirium for patients undergoing surgical interventions were specified. The ability to make strong recommendations was limited by the low quality of evidence and the presence of uncertainty. Moreover, weak recommendations were provided for the use of multicomponent interventions to treat delirium of older patients (medical wards).ConclusionsOverall, the panel developed 12 recommendations for the delivery of non-pharmacological interventions to older patients at risk of developing or, with delirium.