Junmin Zhu

Whole genome sequencing of a novel temperate bacteriophage of P. aeruginosa: evidence of tRNA gene mediating integration of the phage genome into the host bacterial chromosome

Whole genome sequencing of a novel Pseudomonas aeruginosa temperate bacteriophage PaP3 has been completed. The genome contains 45 503 bp with GC content of 52.1%, without more than 100 bp sequence hitting homologue in all sequenced phage genomes. A total of 256 open reading frames (ORFs) are found in the genome, and 71 ORFs are predicated as coding sequence (CDS). All 71 CDS are divided into the two opposite direction groups, and both groups meet at the bidirectional terminator site locating the near middle of the genome. The genome is dsDNA with 5′‐protruded cohesive ends and cohesive sequence is ′GCCGGCCCCTTTCCGCGTTA′ (20 mer). There are four tRNA genes (tRNAAsn, tRNAAsp, tRNATyr and tRNAPro) clustering at the 5′‐terminal of the genome. Analysis of integration site of PaP3 in the host bacterial genome confirmed that the core sequence of (GGTCGTAGGTTCGAATCCTAC‐21mer) locates at tRNAPro gene within the attP region and at tRNALys gene in the attB region. The results indicated that 3′‐end of tRNAPro gene of the PaP3 genome is involved in the integration reaction and 5′‐end of tRNALys gene of host bacteria genome is hot spot of the integration.

Genomic and Proteomic Analyses of the Terminally Redundant Genome of the Pseudomonas aeruginosa Phage PaP1: Establishment of Genus PaP1-Like Phages

We isolated and characterized a new Pseudomonas aeruginosa myovirus named PaP1. The morphology of this phage was visualized by electron microscopy and its genome sequence and ends were determined. Finally, genomic and proteomic analyses were performed. PaP1 has an icosahedral head with an apex diameter of 68–70 nm and a contractile tail with a length of 138–140 nm. The PaP1 genome is a linear dsDNA molecule containing 91,715 base pairs (bp) with a G+C content of 49.36% and 12 tRNA genes. A strategy to identify the genome ends of PaP1 was designed. The genome has a 1190 bp terminal redundancy. PaP1 has 157 open reading frames (ORFs). Of these, 143 proteins are homologs of known proteins, but only 38 could be functionally identified. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis and high-performance liquid chromatography-mass spectrometry allowed identification of 12 ORFs as structural protein coding genes within the PaP1 genome. Comparative genomic analysis indicated that the Pseudomonas aeruginosa phage PaP1, JG004, PAK_P1 and vB_PaeM_C2-10_Ab1 share great similarity. Besides their similar biological characteristics, the phages contain 123 core genes and have very close phylogenetic relationships, which distinguish them from other known phage genera. We therefore propose that these four phages be classified as PaP1-like phages, a new phage genus of Myoviridae that infects Pseudomonas aeruginosa.

Molecular and phenotypic evidence for the spread of three major methicillin-resistant Staphylococcus aureus clones associated with two characteristic antimicrobial resistance profiles in China

OBJECTIVES The distribution of methicillin-resistant Staphylococcus aureus (MRSA) clones is dynamic and geographically unique. To understand the changing epidemiology of MRSA infections in China, we performed a prospective, multicity surveillance study with molecular typing and phenotypic analysis to determine the association of major prevalent clones with their antimicrobial resistance profiles. METHODS A total of 517 S. aureus isolates collected between January 2009 and March 2012 from six cities in China were subjected to antibiogram analysis and molecular typing, including staphylococcal cassette chromosome mec typing, multilocus sequence typing, staphylococcal protein A gene typing and PFGE typing. RESULTS Among the isolates collected, 309 were characterized as MRSA, with a prevalence of 59.8%. Three major clones were found to be prevalent in China: ST239-MRSA-III-t030, ST239-MRSA-III-t037 and ST5-MRSA-II-t002. These three clones were associated with two characteristic resistance profiles, namely, gentamicin/ciprofloxacin/rifampicin/levofloxacin for the first clone and gentamicin/ciprofloxacin/clindamycin/erythromycin/tetracycline/levofloxacin/trimethoprim/sulfamethoxazole for the latter two. Several geographically unique minor clones were also identified. CONCLUSIONS The predominant MRSA clones in China were associated with characteristic antimicrobial resistance profiles. Antibiotics for treating patients with MRSA infections can be selected based on the strain typing data.

Cell wall thickening is associated with adaptive resistance to amikacin in methicillin-resistant Staphylococcus aureus clinical isolates

OBJECTIVES Methicillin-resistant Staphylococcus aureus (MRSA) infection is increasing and causing global concern. The mechanism of MRSA resistance to amikacin is poorly understood. We report on the first matched-pair study to reveal that the phenotypic cell wall thickening of MRSA is associated with adaptive resistance to amikacin. METHODS Two MRSA strains (CY001 and CY002) were isolated from blood and synovial fluid samples, respectively, from a 12-year-old male patient with osteomyelitis. The strains were subjected to a matched-pair study, including antimicrobial agent susceptibility determination, molecular typing, morphological observation and in vitro resistance induction. RESULTS Both strains are Panton-Valentine leucocidin-positive, multilocus sequence type 59, staphylococcal cassette chromosome mec type IV and spa type 437 MRSA with identical PFGE profiles. The drug susceptibility spectra of the two isolates are similar. However, CY001 is resistant to amikacin (CY001-AMI(R); MIC = 64 mg/L), contrary to the susceptible CY002 (CY002-AMI(S); MIC = 8 mg/L). CY001-AMI(R) may have developed adaptive resistance, because it lacks aminoglycoside-modifying enzymes and has an altered growth curve. Interestingly, CY001-AMI(R) has a thicker cell wall (36.43 ± 4.25 nm) than CY002-AMI(S) (18.15 ± 3.74 nm) in the presence of amikacin at its MIC. The thickened cell wall can also be observed in an in vitro-induced strain (CY002-AMI(R)) in the presence of amikacin at its MIC (36.78 ± 3.41 nm); this strain was obtained by gradually increasing the amount of amikacin. However, the cell wall-thickened strains cultured in the presence of amikacin are still susceptible to vancomycin. CONCLUSIONS Cell wall thickening is associated with adaptive resistance in MRSA and alternative antibiotics can be used to treat patients when adaptive resistance to amikacin has developed.

Genetic polymorphisms of molecules involved in host immune response to dengue virus infection

The dengue virus (DENV) belongs to the flavivirus family. Each of the four distinct serotypes of this virus is capable of causing human disease, especially in tropical and subtropical areas. The majority of people infected with DENV manifest asymptomatic or dengue fever with flu-like self-limited symptoms. However, a small portion of patients emerge with severe manifestations referred to as dengue hemorrhagic fever, which has a high mortality rate if not treated promptly. The host immune system, which plays important roles throughout the whole process of DENV infection, has been confirmed to have double-edged effects on DENV infection. Recently, much attention has been paid to the genetic heterogeneity of molecules involved in the host immune response to DENV infection. This heterogeneity has been proved to be the determining factor for DENV disease orientation. The present review discusses the primary functions and single nucleotide polymorphisms of some critical molecules in the human DENV immunological defense, especially the polymorphism locus associated with the DENV pathogenesis and disease susceptibility.

Morganella morganii, a non-negligent opportunistic pathogen

Morganella morganii belongs to the tribe Proteeae of the Enterobacteriaceae family. This species is considered as an unusual opportunistic pathogen that mainly causes post-operative wound and urinary tract infections. However, certain clinical M. morganii isolates present resistance to multiple antibiotics by carrying various resistant genes (such as blaNDM-1, and qnrD1), thereby posing a serious challenge for clinical infection control. Moreover, virulence evolution makes M. morganii an important pathogen. Accumulated data have demonstrated that M. morganii can cause various infections, such as sepsis, abscess, purple urine bag syndrome, chorioamnionitis, and cellulitis. This bacterium often results in a high mortality rate in patients with some infections. M. morganii is considered as a non-negligent opportunistic pathogen because of the increased levels of resistance and virulence. In this review, we summarized the epidemiology of M. morganii, particularly on its resistance profile and resistant genes, as well as the disease spectrum and risk factors for its infection.

Panton-Valentine Leukocidin (PVL)-Positive Health Care-Associated Methicillin-Resistant Staphylococcus aureus Isolates Are Associated with Skin and Soft Tissue Infections and Colonized Mainly by Infective PVL-Encoding Bacteriophages

ABSTRACT The emergence of Panton-Valentine leukocidin (PVL)-positive methicillin-resistant Staphylococcus aureus (MRSA) is a public health concern worldwide. PVL is associated with community-associated MRSA and is linked to skin and soft tissue infections (SSTIs). However, PVL genes have also been detected in health care-associated (HA) MRSA isolates. The diseases associated with PVL-positive HA-MRSA isolates and the distributions of PVL-encoding bacteriophages in HA-MRSA have not been determined. In this study, a total of 259 HA-MRSA strains isolated between 2009 and 2012 in China from inpatients with SSTIs, pneumonia, and bacteremia were selected for molecular typing, including staphylococcal cassette chromosome mec typing, multilocus sequence typing, and staphylococcal protein A gene typing. The PVL genes and PVL bacteriophages in the MRSA isolates were characterized by PCR. Among the tested MRSA isolates, 28.6% (74/259) were PVL positive. The high prevalence of PVL-carrying HA-MRSA was observed to be associated with SSTIs but not with pneumonia or bacteremia. The PVL-positive HA-MRSA isolates were colonized mainly by infective PVL phages, namely, Φ7247PVL, ΦSLT, and ΦSa2958. The distribution of PVL-carrying bacteriophages differed geographically. Our study highlights the potential risk of the emergence of multidrug-resistant HA-MRSA strains with increased virulence.

Identification of lytic bacteriophage MmP1, assigned to a new member of T7-like phages infecting Morganella morganii

MmP1 (Morganella morganii phage 1) is a lytic bacteriophage newly isolated from the host bacterium M. morganii. The entire genome was sequenced, and final assembly yielded a 38,234bp linear double-stranded DNA (dsDNA) with a G+C content of 46.5%. In the MmP1 genome, 49 putative genes, 10 putative promoters and 2 predicted sigma-independent terminators were determined through bioinformatic analysis. A striking feature of the MmP1 genome is its high degree of similarity to the T7 group of phages. All of the 49 predicted genes exist on the same DNA strand, and functions were assigned to 35 genes based on the similarity of the homologues deposited in GenBank, which share 30-80% identity to their counterparts in T7-like phages. The analyses of MmP1 using CoreGenes, phylogenetic tree of RNA polymerase and structural proteins have demonstrated that bacteriophage MmP1 should be assigned as a new member of T7-like phages but as a relatively distant member of this family. This is the first report that a T7-like phage adaptively parasitizes in M. morganii, and this will advance our understanding of biodiversity and adaptive evolution of T7-like phages.

First report of a sequence type 239 vancomycin-intermediate Staphylococcus aureus isolate in Mainland China.

Methicillin-resistant Staphylococcus aureus (MRSA) is an important pathogen that causes a wide range of both hospital- and community-acquired infections. The high prevalence of MRSA and the extensive use of vancomycin in Mainland China may lead to the emergence of vancomycin-intermediate S. aureus (VISA) isolates. In this case, we report a VISA isolate from a 34-year-old male patient with steam burn. The isolate was determined to be sequence type 239 staphylococcal cassette chromosome mec type III, the most prevalent MRSA clone in Mainland China.

Characterization and genome sequencing of a novel coliphage isolated from engineered Escherichia coli.

Objectives: To characterize morphological, physicochemical and genomic features of a novel virulent coliphage which was isolated from an engineered Escherichia coli culture and termed engineered E. coli phage (EEP). Methods and Results: Electron microscopy revealed that EEP has an icosahedral head (62 nm in diameter) and a long, flexible tail (138 nm in length). EEP was able to infect all 10 engineered E. coli strains kept in our laboratory, showing a strong ability to lyse engineered E. coli. Sequencing of the EEP genome revealed a double-stranded DNA (39.8 kb) with 54.72% GC content. Fifty-two open reading frames were predicted to be coding sequences, 18 of which were functionally defined and organized in a modular format, which includes modules for DNA replication, DNA packaging, structural proteins and host cell lysis. This phage could not be inactivated at 90° for 45 min and was resistant to ethanol and alkali treatment. EEP is assigned to the Siphoviridae family based on its morphological, genomic and physicochemical properties. Conclusions: A novel coliphage was isolated from engineered E. coli strains, and its morphological, genomic and physicochemical properties were characterized, which will improve our knowledge of bacteriophage diversity.