Xiaomei Hu

Whole genome sequencing of a novel temperate bacteriophage of P. aeruginosa: evidence of tRNA gene mediating integration of the phage genome into the host bacterial chromosome

Whole genome sequencing of a novel Pseudomonas aeruginosa temperate bacteriophage PaP3 has been completed. The genome contains 45 503 bp with GC content of 52.1%, without more than 100 bp sequence hitting homologue in all sequenced phage genomes. A total of 256 open reading frames (ORFs) are found in the genome, and 71 ORFs are predicated as coding sequence (CDS). All 71 CDS are divided into the two opposite direction groups, and both groups meet at the bidirectional terminator site locating the near middle of the genome. The genome is dsDNA with 5′‐protruded cohesive ends and cohesive sequence is ′GCCGGCCCCTTTCCGCGTTA′ (20 mer). There are four tRNA genes (tRNAAsn, tRNAAsp, tRNATyr and tRNAPro) clustering at the 5′‐terminal of the genome. Analysis of integration site of PaP3 in the host bacterial genome confirmed that the core sequence of (GGTCGTAGGTTCGAATCCTAC‐21mer) locates at tRNAPro gene within the attP region and at tRNALys gene in the attB region. The results indicated that 3′‐end of tRNAPro gene of the PaP3 genome is involved in the integration reaction and 5′‐end of tRNALys gene of host bacteria genome is hot spot of the integration.

Molecular and phenotypic evidence for the spread of three major methicillin-resistant Staphylococcus aureus clones associated with two characteristic antimicrobial resistance profiles in China

OBJECTIVES The distribution of methicillin-resistant Staphylococcus aureus (MRSA) clones is dynamic and geographically unique. To understand the changing epidemiology of MRSA infections in China, we performed a prospective, multicity surveillance study with molecular typing and phenotypic analysis to determine the association of major prevalent clones with their antimicrobial resistance profiles. METHODS A total of 517 S. aureus isolates collected between January 2009 and March 2012 from six cities in China were subjected to antibiogram analysis and molecular typing, including staphylococcal cassette chromosome mec typing, multilocus sequence typing, staphylococcal protein A gene typing and PFGE typing. RESULTS Among the isolates collected, 309 were characterized as MRSA, with a prevalence of 59.8%. Three major clones were found to be prevalent in China: ST239-MRSA-III-t030, ST239-MRSA-III-t037 and ST5-MRSA-II-t002. These three clones were associated with two characteristic resistance profiles, namely, gentamicin/ciprofloxacin/rifampicin/levofloxacin for the first clone and gentamicin/ciprofloxacin/clindamycin/erythromycin/tetracycline/levofloxacin/trimethoprim/sulfamethoxazole for the latter two. Several geographically unique minor clones were also identified. CONCLUSIONS The predominant MRSA clones in China were associated with characteristic antimicrobial resistance profiles. Antibiotics for treating patients with MRSA infections can be selected based on the strain typing data.

Cell wall thickening is associated with adaptive resistance to amikacin in methicillin-resistant Staphylococcus aureus clinical isolates

OBJECTIVES Methicillin-resistant Staphylococcus aureus (MRSA) infection is increasing and causing global concern. The mechanism of MRSA resistance to amikacin is poorly understood. We report on the first matched-pair study to reveal that the phenotypic cell wall thickening of MRSA is associated with adaptive resistance to amikacin. METHODS Two MRSA strains (CY001 and CY002) were isolated from blood and synovial fluid samples, respectively, from a 12-year-old male patient with osteomyelitis. The strains were subjected to a matched-pair study, including antimicrobial agent susceptibility determination, molecular typing, morphological observation and in vitro resistance induction. RESULTS Both strains are Panton-Valentine leucocidin-positive, multilocus sequence type 59, staphylococcal cassette chromosome mec type IV and spa type 437 MRSA with identical PFGE profiles. The drug susceptibility spectra of the two isolates are similar. However, CY001 is resistant to amikacin (CY001-AMI(R); MIC = 64 mg/L), contrary to the susceptible CY002 (CY002-AMI(S); MIC = 8 mg/L). CY001-AMI(R) may have developed adaptive resistance, because it lacks aminoglycoside-modifying enzymes and has an altered growth curve. Interestingly, CY001-AMI(R) has a thicker cell wall (36.43 ± 4.25 nm) than CY002-AMI(S) (18.15 ± 3.74 nm) in the presence of amikacin at its MIC. The thickened cell wall can also be observed in an in vitro-induced strain (CY002-AMI(R)) in the presence of amikacin at its MIC (36.78 ± 3.41 nm); this strain was obtained by gradually increasing the amount of amikacin. However, the cell wall-thickened strains cultured in the presence of amikacin are still susceptible to vancomycin. CONCLUSIONS Cell wall thickening is associated with adaptive resistance in MRSA and alternative antibiotics can be used to treat patients when adaptive resistance to amikacin has developed.

Design and expression of peptide antibiotic hPAB-β as tandem multimers in Escherichia coli

Peptide antibiotics are small peptides encoded by organism genomic DNA. They are recognized to play important roles in the innate host defense of most living organisms. The growing resistance of bacteria to conventional antibiotics and the need for discovery of new antibiotics have stimulated great interest in the development of peptide antibiotics as human therapeutics. However, preparation of peptide antibiotics at a large scale is a great challenge in developing these commercial products. In this study, tandem repeat multimers of peptide antibiotic hPAB-beta were designed and the recombinant plasmids containing one to eight copies of hPAB-beta gene were generated. Eight genetic engineered bacteria harboring pQE-hPAB-beta1-8 recombinant were able to express the repetitive hPAB-beta multimers of interest in inclusion bodies, respectively. The expressed proteins could reach 2.6-28% of the total proteins. The hPAB-beta trimer construct was selected out for the subsequent study based on its higher expression level (27.8%), which yields in wet cell weights (3.15+/-0.45 g/l) and the fusion protein inclusion bodies was able to completely dissolve in 8 M urea. The tandem trimers could easily be captured by Ni-NTA affinity chromatography and cleaved into monomers by hydroxylamine. Then, the monomer hPAB-beta of interest was purified to 95% homogeneity by reverse phase chromatography and gel filtration. The final yield of purified recombinant monomer hPAB-beta was 680+/-12 mg/100 g wet cells. The minimum inhibitory concentrations (MICs) of the purified recombinant hPAB-beta against type or clinical strains of microorganisms were about 31-250 microg/ml and these results showed that the recombinant hPAB-beta could retain its bioactivity.

Staphylococcus aureus ST121: a globally disseminated hypervirulent clone.

Staphylococcus aureus is a leading cause of bacterial infections in hospitals and communities worldwide. With the development of typing methods, several pandemic clones have been well characterized, including the extensively spreading hospital-associated meticillin-resistant S. aureus (HA-MRSA) clone ST239 and the emerging hypervirulent community-associated (CA) MRSA clone USA300. The multilocus sequence typing method was set up based on seven housekeeping genes; S. aureus groups were defined by the sharing of alleles at ≥ 5 of the seven loci. In many cases, the predicted founder of a group would also be the most prevalent ST within the group. As a predicted founder of major S. aureus groups, approximately 90 % of ST121 strains was meticillin-susceptible S. aureus (MSSA). The majority of ST121 strains carry accessory gene regulator type IV, whereas staphylococcal protein A gene types for ST121 are exceptionally diverse. More than 90 % of S. aureus ST121 strains have Panton-Valentine leukocidin; other enterotoxins, haemolysins, leukocidins and exfoliative toxins also contribute to the high virulence of ST121 strains. Patients suffering from S. aureus ST121 infections often need longer hospitalization and prolonged antimicrobial therapy. In this review, we tried to summarize the epidemiology of the S. aureus clone ST121 and focused on the molecular types, toxin carriage and disease spectrum of this globally disseminated clone.

Panton-Valentine Leukocidin (PVL)-Positive Health Care-Associated Methicillin-Resistant Staphylococcus aureus Isolates Are Associated with Skin and Soft Tissue Infections and Colonized Mainly by Infective PVL-Encoding Bacteriophages

ABSTRACT The emergence of Panton-Valentine leukocidin (PVL)-positive methicillin-resistant Staphylococcus aureus (MRSA) is a public health concern worldwide. PVL is associated with community-associated MRSA and is linked to skin and soft tissue infections (SSTIs). However, PVL genes have also been detected in health care-associated (HA) MRSA isolates. The diseases associated with PVL-positive HA-MRSA isolates and the distributions of PVL-encoding bacteriophages in HA-MRSA have not been determined. In this study, a total of 259 HA-MRSA strains isolated between 2009 and 2012 in China from inpatients with SSTIs, pneumonia, and bacteremia were selected for molecular typing, including staphylococcal cassette chromosome mec typing, multilocus sequence typing, and staphylococcal protein A gene typing. The PVL genes and PVL bacteriophages in the MRSA isolates were characterized by PCR. Among the tested MRSA isolates, 28.6% (74/259) were PVL positive. The high prevalence of PVL-carrying HA-MRSA was observed to be associated with SSTIs but not with pneumonia or bacteremia. The PVL-positive HA-MRSA isolates were colonized mainly by infective PVL phages, namely, Φ7247PVL, ΦSLT, and ΦSa2958. The distribution of PVL-carrying bacteriophages differed geographically. Our study highlights the potential risk of the emergence of multidrug-resistant HA-MRSA strains with increased virulence.

First report of a sequence type 239 vancomycin-intermediate Staphylococcus aureus isolate in Mainland China.

Methicillin-resistant Staphylococcus aureus (MRSA) is an important pathogen that causes a wide range of both hospital- and community-acquired infections. The high prevalence of MRSA and the extensive use of vancomycin in Mainland China may lead to the emergence of vancomycin-intermediate S. aureus (VISA) isolates. In this case, we report a VISA isolate from a 34-year-old male patient with steam burn. The isolate was determined to be sequence type 239 staphylococcal cassette chromosome mec type III, the most prevalent MRSA clone in Mainland China.

Characterization and genome sequencing of a novel coliphage isolated from engineered Escherichia coli.

Objectives: To characterize morphological, physicochemical and genomic features of a novel virulent coliphage which was isolated from an engineered Escherichia coli culture and termed engineered E. coli phage (EEP). Methods and Results: Electron microscopy revealed that EEP has an icosahedral head (62 nm in diameter) and a long, flexible tail (138 nm in length). EEP was able to infect all 10 engineered E. coli strains kept in our laboratory, showing a strong ability to lyse engineered E. coli. Sequencing of the EEP genome revealed a double-stranded DNA (39.8 kb) with 54.72% GC content. Fifty-two open reading frames were predicted to be coding sequences, 18 of which were functionally defined and organized in a modular format, which includes modules for DNA replication, DNA packaging, structural proteins and host cell lysis. This phage could not be inactivated at 90° for 45 min and was resistant to ethanol and alkali treatment. EEP is assigned to the Siphoviridae family based on its morphological, genomic and physicochemical properties. Conclusions: A novel coliphage was isolated from engineered E. coli strains, and its morphological, genomic and physicochemical properties were characterized, which will improve our knowledge of bacteriophage diversity.

ROCK is Involved in Vimentin Phosphorylation and Rearrangement Induced by Dengue Virus

Our previous study showed that dengue virus 2 (DENV2) infection induces rearrangement of vimentin into dense structures at the perinuclear area. However, the underlying mechanism of this phenomenon is poorly characterized. In the present work, we found that vimentin and Ser71 phosphorylated vimentin display similar distributions in DENV2-infected cells. DENV2 infection also induced ROCK activation and phosphorylation of vimentin at Ser71 as the DENV2 infection progressed. Furthermore, Ser71 phosphorylation and vimentin rearrangement induced by DENV2 infection were blocked by the ROCK inhibitor Y-27632. In addition, DENV2 led to endoplasmic reticulum (ER) redistribution in the perinuclear region of the host cells, which was partially blocked by pretreatment with Y-27632. Together, these data support indicate that ROCK may have a role in governing regulating vimentin and ER rearrangement during DENV2 infection. We hypothesize that DENV2 infection, via ROCK activation, induces both vimentin rearrangement and ER redistribution around the perinuclear region, which may play a structural role in anchoring DENV2 to replication sites.

Eliciting cross-neutralizing antibodies in mice challenged with a dengue virus envelope domain III expressed in Escherichia coli.

Dengue viruses (DENVs) are mosquito-borne infectious pathogens that pose a serious global public health threat, and at present, no therapy or effective vaccines are available. Choosing suitable units as candidates is fundamental for the development of a dengue subunit vaccine. Domain III of the DENV-2 E protein (EDIII) was chosen in the present study and expressed in Escherichia coli by N-terminal fusion to a bacterial leader (pelB), and C-terminal fusion with a 6×His tag based on the functions of DENV structure proteins, especially the neutralizing epitopes on the envelope E protein. After two-step purification using Ni-NTA affinity and cation-exchange chromatography, the His-tagged EDIII was purified up to 98% homogenicity. This recombinant EDIII was able to trigger high levels of neutralizing antibodies in both BALB/c and C57BL/6 mice. Both the recombinant EDIII and its murine antibodies protected Vero cells from DENV-2 infection. Interestingly, the recombinant EDIII provides at least partial cross-protection against DENV-1 infection. In addition, the EDIII antibodies were able to protect suckling mice from virus challenge in vivo. These data suggest that a candidate molecule based on the small EDIII protein, which has neutralizing epitopes conserved among all 4 DENV serotypes, has important implications.