Kin Mok

A hexanucleotide repeat expansion in C9ORF72 is the cause of chromosome 9p21-linked ALS-FTD

The chromosome 9p21 amyotrophic lateral sclerosis-frontotemporal dementia (ALS-FTD) locus contains one of the last major unidentified autosomal-dominant genes underlying these common neurodegenerative diseases. We have previously shown that a founder haplotype, covering the MOBKL2b, IFNK, and C9ORF72 genes, is present in the majority of cases linked to this region. Here we show that there is a large hexanucleotide (GGGGCC) repeat expansion in the first intron of C9ORF72 on the affected haplotype. This repeat expansion segregates perfectly with disease in the Finnish population, underlying 46.0% of familial ALS and 21.1% of sporadic ALS in that population. Taken together with the D90A SOD1 mutation, 87% of familial ALS in Finland is now explained by a simple monogenic cause. The repeat expansion is also present in one-third of familial ALS cases of outbred European descent, making it the most common genetic cause of these fatal neurodegenerative diseases identified to date.

Frequency of the C9orf72 hexanucleotide repeat expansion in patients with amyotrophic lateral sclerosis and frontotemporal dementia: A cross-sectional study

Summary Background We aimed to accurately estimate the frequency of a hexanucleotide repeat expansion in C9orf72 that has been associated with a large proportion of cases of amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD). Methods We screened 4448 patients diagnosed with ALS (El Escorial criteria) and 1425 patients with FTD (Lund-Manchester criteria) from 17 regions worldwide for the GGGGCC hexanucleotide expansion using a repeat-primed PCR assay. We assessed familial disease status on the basis of self-reported family history of similar neurodegenerative diseases at the time of sample collection. We compared haplotype data for 262 patients carrying the expansion with the known Finnish founder risk haplotype across the chromosomal locus. We calculated age-related penetrance using the Kaplan-Meier method with data for 603 individuals with the expansion. Findings In patients with sporadic ALS, we identified the repeat expansion in 236 (7·0%) of 3377 white individuals from the USA, Europe, and Australia, two (4·1%) of 49 black individuals from the USA, and six (8·3%) of 72 Hispanic individuals from the USA. The mutation was present in 217 (39·3%) of 552 white individuals with familial ALS from Europe and the USA. 59 (6·0%) of 981 white Europeans with sporadic FTD had the mutation, as did 99 (24·8%) of 400 white Europeans with familial FTD. Data for other ethnic groups were sparse, but we identified one Asian patient with familial ALS (from 20 assessed) and two with familial FTD (from three assessed) who carried the mutation. The mutation was not carried by the three Native Americans or 360 patients from Asia or the Pacific Islands with sporadic ALS who were tested, or by 41 Asian patients with sporadic FTD. All patients with the repeat expansion had (partly or fully) the founder haplotype, suggesting a one-off expansion occurring about 1500 years ago. The pathogenic expansion was non-penetrant in individuals younger than 35 years, 50% penetrant by 58 years, and almost fully penetrant by 80 years. Interpretation A common Mendelian genetic lesion in C9orf72 is implicated in many cases of sporadic and familial ALS and FTD. Testing for this pathogenic expansion should be considered in the management and genetic counselling of patients with these fatal neurodegenerative diseases. Funding Full funding sources listed at end of paper (see Acknowledgments).

Frontotemporal dementia with the C9ORF72 hexanucleotide repeat expansion: clinical, neuroanatomical and neuropathological features

An expanded hexanucleotide repeat in the C9ORF72 gene has recently been identified as a major cause of familial frontotemporal lobar degeneration and motor neuron disease, including cases previously identified as linked to chromosome 9. Here we present a detailed retrospective clinical, neuroimaging and histopathological analysis of a C9ORF72 mutation case series in relation to other forms of genetically determined frontotemporal lobar degeneration ascertained at a specialist centre. Eighteen probands (19 cases in total) were identified, representing 35% of frontotemporal lobar degeneration cases with identified mutations, 36% of cases with clinical evidence of motor neuron disease and 7% of the entire cohort. Thirty-three per cent of these C9ORF72 cases had no identified relevant family history. Families showed wide variation in clinical onset (43–68 years) and duration (1.7–22 years). The most common presenting syndrome (comprising a half of cases) was behavioural variant frontotemporal dementia, however, there was substantial clinical heterogeneity across the C9ORF72 mutation cohort. Sixty per cent of cases developed clinical features consistent with motor neuron disease during the period of follow-up. Anxiety and agitation and memory impairment were prominent features (between a half to two-thirds of cases), and dominant parietal dysfunction was also frequent. Affected individuals showed variable magnetic resonance imaging findings; however, relative to healthy controls, the group as a whole showed extensive thinning of frontal, temporal and parietal cortices, subcortical grey matter atrophy including thalamus and cerebellum and involvement of long intrahemispheric, commissural and corticospinal tracts. The neuroimaging profile of the C9ORF72 expansion was significantly more symmetrical than progranulin mutations with significantly less temporal lobe involvement than microtubule-associated protein tau mutations. Neuropathological examination in six cases with C9ORF72 mutation from the frontotemporal lobar degeneration series identified histomorphological features consistent with either type A or B TAR DNA-binding protein-43 deposition; however, p62-positive (in excess of TAR DNA-binding protein-43 positive) neuronal cytoplasmic inclusions in hippocampus and cerebellum were a consistent feature of these cases, in contrast to the similar frequency of p62 and TAR DNA-binding protein-43 deposition in 53 control cases with frontotemporal lobar degeneration–TAR DNA-binding protein. These findings corroborate the clinical importance of the C9ORF72 mutation in frontotemporal lobar degeneration, delineate phenotypic and neuropathological features that could help to guide genetic testing, and suggest hypotheses for elucidating the neurobiology of a culprit subcortical network.

Chromosome 9p21 in sporadic amyotrophic lateral sclerosis in the UK and seven other countries: a genome-wide association study

Summary Background Amyotrophic lateral sclerosis (ALS) is a neurodegenerative disease of motor neurons that results in progressive weakness and death from respiratory failure, commonly within about 3 years. Previous studies have shown association of a locus on chromosome 9p with ALS and linkage with ALS–frontotemporal dementia. We aimed to test whether this genomic region is also associated with ALS in an independent set of UK samples, and to identify risk factors associated with ALS in a further genome-wide association study that combined data from the independent analysis with those from other countries. Methods We collected samples from patients with sporadic ALS from 20 UK hospitals and obtained UK control samples from the control groups of the Depression Case Control study, the Bipolar Affective Case Control Study, and the British 1958 birth cohort DNA collection. Genotyping of DNA in this independent analysis was done with Illumina HumanHap550 BeadChips. We then undertook a joint genome-wide analysis that combined data from the independent set with published data from the UK, USA, Netherlands, Ireland, Italy, France, Sweden, and Belgium. The threshold for significance was p=0·05 in the independent analysis, because we were interested in replicating a small number of previously reported associations, whereas the Bonferroni-corrected threshold for significance in the joint analysis was p=2·20×10−7 Findings After quality control, samples were available from 599 patients and 4144 control individuals in the independent set. In this analysis, two single nucleotide polymorphisms in a locus on chromosome 9p21.2 were associated with ALS: rs3849942 (p=2·22×10−6; odds ratio [OR] 1·39, 95% CI 1·21–1·59) and rs2814707 (p=3·32×10−6; 1·38, 1·20–1·58). In the joint analysis, which included samples from 4312 patients with ALS and 8425 control individuals, rs3849942 (p=4·64×10−10; OR 1·22, 95% CI 1·15–1·30) and rs2814707 (p=4·72×10−10; 1·22, 1·15–1·30) were associated with ALS. Interpretation We have found strong evidence of a genetic association of two single nucleotide polymorphisms on chromosome 9 with sporadic ALS, in line with findings from previous independent GWAS of ALS and linkage studies of ALS–frontotemporal dementia. Our findings together with these earlier findings suggest that genetic variation at this locus on chromosome 9 causes sporadic ALS and familial ALS–frontotemporal dementia. Resequencing studies and then functional analysis should be done to identify the defective gene. Funding ALS Therapy Alliance, the Angel Fund, the Medical Research Council, the Motor Neurone Disease Association of Great Britain and Northern Ireland, the Wellcome Trust, and the National Institute for Health Research Dementias and Neurodegenerative Diseases Research Network (DeNDRoN).

Clinico-pathological features in amyotrophic lateral sclerosis with expansions in C9ORF72

Intronic expansion of the GGGGCC hexanucleotide repeat within the C9ORF72 gene causes frontotemporal dementia and amyotrophic lateral sclerosis/motor neuron disease in both familial and sporadic cases. Initial reports indicate that this variant within the frontotemporal dementia/amyotrophic lateral sclerosis spectrum is associated with transactive response DNA binding protein (TDP-43) proteinopathy. The amyotrophic lateral sclerosis/motor neuron disease phenotype is not yet well characterized. We report the clinical and pathological phenotypes associated with pathogenic C9ORF72 mutations in a cohort of 563 cases from Northern England, including 63 with a family history of amyotrophic lateral sclerosis. One hundred and fifty-eight cases from the cohort (21 familial, 137 sporadic) were post-mortem brain and spinal cord donors. We screened DNA for the C9ORF72 mutation, reviewed clinical case histories and undertook pathological evaluation of brain and spinal cord. Control DNA samples (n = 361) from the same population were also screened. The C9ORF72 intronic expansion was present in 62 cases [11% of the cohort; 27/63 (43%) familial, 35/500 (7%) cases with sporadic amyotrophic lateral sclerosis/motor neuron disease]. Disease duration was significantly shorter in cases with C9ORF72-related amyotrophic lateral sclerosis (30.5 months) compared with non-C9ORF72 amyotrophic lateral sclerosis/motor neuron disease (36.3 months, P < 0.05). C9ORF72 cases included both limb and bulbar onset disease and all cases showed combined upper and lower motor neuron degeneration (amyotrophic lateral sclerosis). Thus, clinically, C9ORF72 cases show the features of a relatively rapidly progressive, but otherwise typical, variant of amyotrophic lateral sclerosis associated with both familial and sporadic presentations. Dementia was present in the patient or a close family member in 22/62 cases with C9ORF72 mutation (35%) based on diagnoses established from retrospective clinical case note review that may underestimate significant cognitive changes in late disease. All the C9ORF72 mutation cases showed classical amyotrophic lateral sclerosis pathology with TDP-43 inclusions in spinal motor neurons. Neuronal cytoplasmic inclusions and glial inclusions positive for p62 immunostaining in non-motor regions were strongly over-represented in the C9ORF72 cases. Extra-motor pathology in the frontal cortex (P < 0.0005) and the hippocampal CA4 subfield neurons (P < 0.0005) discriminated C9ORF72 cases strongly from the rest of the cohort. Inclusions in CA4 neurons were not present in non-C9ORF72 cases, indicating that this pathology predicts mutation status.

A robust model for read count data in exome sequencing experiments and implications for copy number variant calling

Motivation: Exome sequencing has proven to be an effective tool to discover the genetic basis of Mendelian disorders. It is well established that copy number variants (CNVs) contribute to the etiology of these disorders. However, calling CNVs from exome sequence data is challenging. A typical read depth strategy consists of using another sample (or a combination of samples) as a reference to control for the variability at the capture and sequencing steps. However, technical variability between samples complicates the analysis and can create spurious CNV calls. Results: Here, we introduce ExomeDepth, a new CNV calling algorithm designed to control for this technical variability. ExomeDepth uses a robust model for the read count data and uses this model to build an optimized reference set in order to maximize the power to detect CNVs. As a result, ExomeDepth is effective across a wider range of exome datasets than the previously existing tools, even for small (e.g. one to two exons) and heterozygous deletions. We used this new approach to analyse exome data from 24 patients with primary immunodeficiencies. Depending on data quality and the exact target region, we find between 170 and 250 exonic CNV calls per sample. Our analysis identified two novel causative deletions in the genes GATA2 and DOCK8. Availability: The code used in this analysis has been implemented into an R package called ExomeDepth and is available at the Comprehensive R Archive Network (CRAN). Contact: v.plagnol@ucl.ac.uk Supplementary Information: Supplementary data are available at Bioinformatics online.

The chromosome 9 ALS and FTD locus is probably derived from a single founder

We and others have recently reported an association between amyotrophic lateral sclerosis (ALS) and single nucleotide polymorphisms on chromosome 9p21 in several populations. Here we show that the associated haplotype is the same in all populations and that several families previously shown to have genetic linkage to this region also share this haplotype. The most parsimonious explanation of these data are that there is a single founder for this form of disease.

Parkinson's disease in GTP cyclohydrolase 1 mutation carriers

Mutations in the gene encoding the dopamine-synthetic enzyme GTP cyclohydrolase-1 (GCH1) cause DOPA-responsive dystonia (DRD). Mencacci et al. demonstrate that GCH1 variants are associated with an increased risk of Parkinsons disease in both DRD pedigrees and in patients with Parkinsons disease but without a family history of DRD.

LRBA gene deletion in a patient presenting with autoimmunity without hypogammaglobulinemia

To the Editor: Primary immunodeficiencies are a highly heterogeneous group of genetic disorders caused by Mendelian mutations in more than 150 immune-related genes1. Primary immunodeficiencies manifest as severe and/or disseminated recurrent infections and may also have autoimmune manifestations. We studied a female patient P1 of Pakistani origin who presented at the age of 4 years with a generalized lymphadenopathy, splenomegaly, neutropenia (0.05-0.28 ×109/L) and thrombocytopenia (platelet counts 20-40 ×109/L). A lymph node biopsy showed reactive changes, bone marrow aspirate was unremarkable and anti-neutrophil antibodies were present. She also had chronic diarrhea associated with an autoimmune enteropathy, characterized by duodenal villous atrophy and large bowel lymphocytic infiltration on biopsy. Her initial immunology work up revealed only raised IgG levels (22.6 g/L), raised inflammatory markers and a low number of NK cells (0.00-0.02). Lymphocyte subsets, double negative T-cells, T-cell proliferation assays, IgA (1.33 g/L), IgM (1.43 g/L), tetanus vaccine responses and a nitroblue tetrazolium (NBT) test were normal (Table 1). P1 had no significant history of infections except for a psoas abscess associated with chronic neutropenia. Over time she manifested growth failure and developed new autoimmune features including an episode of erythema nodosum, transient arthritis of both feet and recurrent haemolytic anaemia. As a result, she received several courses of steroids, rituximab (with prophylactic immunoglobulin replacement) and mycophenolate mofetil. Five years after initial presentation, following multiple courses of rituximab, she developed recurrent infections (Streptococcus pneumoniae facial cellulitis, Streptococcus pneumoniae sepsis and Haemophilus influenzae empyema) after withdrawal of immunoglobulin therapy. Although both her CD19+ B-cells and IgG level were normal, further investigation revealed a new-onset antibody deficiency with absent vaccine responses (Table 1). Due to further chest symptoms, despite recommencing immunoglobulin replacement, a chest CT scan was performed that showed extensive lung infiltration. Lung biopsy showed a florid diffuse lymphoid interstitial infiltrate consisting of a mixture of CD3+ T and CD20+ B cells, with scattered lymphoid follicles particularly around airways. No granulomata were seen and stains for bacteria, fungi and mycobacteria, as well as in-situ hybridisation for EBV, were negative. Table 1 Serial immunology assessments Patient P1 was born to a consanguineous marriage of first cousins. Therefore, we hypothesized that her disease is caused by a homozygous mutation. To identify the causative mutation we used exome sequencing. Patient’s blood sample was obtained with informed consent from the parents in accordance with the Declaration of Helsinki and with approval from the ethics committees (04/Q0501/119 and 06/Q0508/16). Library preparation, exome capture and sequencing have been done according to the manufacturers instructions. For exome target enrichment the Agilent SureSelect 38 Mb kit was used. Sequencing was done using Illumina HiSeq with 94 bp paired-end reads. In the exome data we found 17,280 single nucleotide variants and small insertions/deletions, including 424 very rare ones, i.e. those not seen in the 1000 Genomes database (May 2011 data release). However, we found no homozygous loss-of-function mutations. To identify larger deletions and duplications we used a new software tool, ExomeDepth2 (available to download at http://cran.r-project.org/web/packages/ExomeDepth/index.html). We found a large homozygous deletion that removed exons 1 to 30 of the 58-exon LPS-responsive vesicle trafficking, beach and anchor containing (LRBA) gene (Figure 1A). This deletion is novel and not present in the Database of Genomic Variants (DGV, http://projects.tcag.ca/variation/). We validated it using a custom comparative genomic hybridization (CGH) array containing 270 probes in a 288 kb region defined around the LRBA gene (Figure 1B). We then sequenced the exact boundaries of this 252,396-nucleotide deletion (chr4: 151,748,856 - 152,001,251; Figure 1C). Figure 1 Homozygous deletion in the LRBA gene region We established an EBV-transformed B cell line of the patient and studied LRBA expression. We stimulated cells with 0, 1, 10 or 100 ng/ml of LPS for 16 hours. Then we extracted RNA, generated cDNA and amplified a part of the LRBA gene using primers 5′GCAGAAGTCATGCTTGGACA3′ and 5′TTTCGAAGTAGGGTCGCAAT3′. An expected 218 bp product from the LRBA exons 19-21 was present in control, but not in patient P1 (Figure 2A). From the LPS-stimulated cells we also extracted proteins and separated them using SDS PAGE. For Western blotting we used anti-LRBA (Sigma HPA019366) and anti-actin antibodies. We found the LRBA protein with the expected mass of approximately 319 kDa in control cells, but not in cells of patient P1 (Figure 2B). We also used immunofluorescence analysis and again found that LRBA protein is expressed in the cytoplasm of cells from a healthy control, but not from patient P1 (Figure 2C).. Figure 2 LRBA mRNA and protein are expressed in the EBV-transformed B cell line from a healthy control, but are absent in patient P1 The LRBA gene encodes a large broadly expressed protein of unknown function that is involved in intracellular vesicle trafficking3. Recently Lopez-Herrera et al. reported five patients with different homozygous mutations in the LRBA gene that also abolished its expression4. These patients had idiopathic thrombocytopenic purpura, lymphoid interstitial pneumonia and autoimmune enteropathy, as well as hypogammaglobulinemia. Reduced levels of IgG and IgA were found in all five patients and reduced IgM was recorded in four of those. Accordingly, all five patients have been diagnosed with childhood-onset common variable immunodeficiency (CVID). Patient P1 that we report here had many similar clinical features. However, hypogammaglobulinemia was not seen at presentation but occurred as a later event, and may have been secondary to rituximab therapy, as has previously been described5. Thus, our results show that deficiency caused by mutations in the LRBA gene may initially present as an autoimmune syndrome without CVID. Therefore, a possibility of LRBA gene mutations should be considered for a broad spectrum of patients with primary immunodeficiencies and autoimmunity.

Screening for C9ORF72 repeat expansion in FTLD

In the present study we aimed to determine the prevalence of C9ORF72 GGGGCC hexanucleotide expansion in our cohort of 53 frontotemporal lobar degeneration (FTLD) patients and 174 neurologically normal controls. We identified the hexanucleotide repeat, in the pathogenic range, in 4 (2 bv-frontotemporal dementia (FTD) and 2 FTD-amyotrophic lateral sclerosis [ALS]) out of 53 patients and 1 neurologically normal control. Interestingly, 2 of the C9ORF72 expansion carriers also carried 2 novel missense mutations in GRN (Y294C) and in PSEN-2(I146V). Further, 1 of the C9ORF72 expansion carriers, for whom pathology was available, showed amyloid plaques and tangles in addition to TAR (trans-activation response) DNA-binding protein (TDP)-43 pathology. In summary, our findings suggest that the hexanucleotide expansion is probably associated with ALS, FTD, or FTD-ALS and occasional comorbid conditions such as Alzheimers disease. These findings are novel and need to be cautiously interpreted and most importantly replicated in larger numbers of samples.