M. Hussain

The Nuclear Shuttle Protein of Tomato Leaf Curl New Delhi Virus Is a Pathogenicity Determinant

ABSTRACT The role of the movement protein (MP) and nuclear shuttle protein (NSP) in the pathogenicity of Tomato leaf curl New Delhi virus (ToLCNDV), a bipartite begomovirus, was studied. Both genes were expressed in Nicotiana benthamiana, Nicotiana tabacum, and Lycopersicon esculentum plants with the Potato virus X (PVX) expression vector or by stable transformation of gene constructs under the control of the 35S promoter in N. tabacum. No phenotypic changes were observed in any of the three species when the MP was expressed from the PVX vector or constitutively expressed in transgenic plants. Expression of the ToLCNDV NSP from the PVX vector in N. benthamiana resulted in leaf curling that is typical of the disease symptoms caused by ToLCNDV in this species. Expression of NSP from PVX in N. tabacum and L. esculentum resulted in a hypersensitive response (HR), demonstrating that the ToLCVDV NSP is a target of host defense responses in these hosts. The NSP, when expressed as a transgene under the control of the 35S promoter, resulted in necrotic lesions in expanded leaves that initiated from a point and then spread across the leaf. The necrotic response was systemic in all the transgenic plants. Deletion of 100 amino acids from the C terminus did not compromise the HR response, suggesting that this region has no role in HR. Deletion of 60 or 100 amino acids from the N terminus of NSP abolished the HR response, suggesting that these sequences are required for the HR response. These findings demonstrate that the ToLCNDV NSP is a pathogenicity determinant as well as a target of host defense responses.

Mobilisation into cotton and spread of a recombinant cotton leaf curl disease satellite.

Summary.Analysis of a DNA β satellite associated with a recently identified cotton leaf curl disease (CLCuD) strain indicated it to be recombinant, with most of the molecule originating from CLCuD DNA β but with some sequence from a satellite isolated from tomato. Analysis of both archival (pre 2001) and recent cotton samples, shows the recombinant satellite is confined to a small area but was not present in cotton prior to 2001. This indicates that the recombinant DNA β was recently mobilized into cotton, likely from tomato, and that recombination plays a role in the evolution of these satellites.

The Hypersensitive Response to Tomato leaf curl New Delhi virus Nuclear Shuttle Protein Is Inhibited by Transcriptional Activator Protein

The hypersensitive response (HR) is a common feature of plant disease resistance reactions and a type of programmed cell death (PCD). Many pathogens are able to modulate pathways involved in cell death. In contrast to animal viruses, inhibitors of PCD activity have not been identified for plant-infecting viruses. Previously, we have reported that the nuclear shuttle protein (NSP) of Tomato leaf curl New Delhi virus (ToLCNDV) induces an HR in Nicotiana tabacum and Lycopersicon esculentum plants when expressed under the control of the Cauliflower mosaic virus 35S promoter. However, HR is not evident in plants infected with ToLCNDV, suggesting that the virus encodes a factor (or factors) that counters this response. Analysis of all ToLCNDV-encoded genes pinpointed the transcriptional activator protein (TrAP) as the factor mediating the anti-HR effect. Deletion mutagenesis showed the central region of TrAP, containing a zinc finger domain and nuclear localization signal, to be important in inhibiting the HR. These results demonstrate that TrAP counters HR-induced cell death, the first such activity identified for a plant-infecting virus.

Association of a Disease Complex Involving a Begomovirus, DNA 1 and a Distinct DNA Beta with Leaf Curl Disease of Okra in Pakistan

Okra leaf curl disease (OLCD), characterized by either upward or downward leaf curl and stunted plant growth, is one of the major diseases of okra (Hibiscus esculentis L.) in Pakistan. OLCD is transmitted by the whitefly Bemisia tabaci and is suspected of being associated with a whitefly-transmitted geminivirus (Genus Begomovirus). Total DNAs isolated from both symptomatic and healthy okra plants collected from several locations in Pakistan were resolved on agarose gels and blotted to nylon membranes. A full-length DNA A clone of Cotton leaf curl virus (CLCuV) from Pakistan (2) was labeled with 32PdCTP and used as a probe at medium stringency. The probe detected the presence of characteristic geminivirus DNA forms in infected plants, while no hybridization was observed to healthy plant extracts, confirming the association of a begomovirus with OLCD. Degenerate oligonucleotide primers based on conserved sequences of DNA B components of begomoviruses were used in PCR for the detection of a potential DNA B (3). No amplification was observed with these primers from okra plants, while amplification of a product of expected size was obtained from plants infected with African cassava mosaic virus, suggesting the lack of a genomic component equivalent to DNA B. We have reported previously that monopartite begomoviruses on cotton and Ageratum conyzoides in Pakistan are associated with a disease complex involving a DNA component termed DNA 1, which shows homology to components of nanoviruses that encode the replication-associated protein (2). Recently, another molecule, DNA beta, has been identified, associated with Ageratum yellow vein disease from Singapore (4) and with cotton leaf curl disease (CLCuD) from Pakistan (1). These molecules are DNAs satellite and are essential for the development of typical disease symptoms in their respective hosts. Duplicate blots were probed for the presence of DNAs homologous to DNA 1 and DNA beta (using full-length clones of these molecules isolated from CLCuD originating from Pakistan [1,2]) and washed at medium stringency. The probes detected bands hybridizing to DNA 1 in extracts from infected okra plants but not DNA beta. No hybridizing bands were detected for either probe in extracts from healthy okra. A pair of primers, designed to conserved sequences in DNA beta molecules (4), were used in PCR for the amplification of DNA beta from symptomatic plants. The use of these primers amplified a product of the expected size (approximately 1.35 kb) from extracts of infected okra plants. The amplified DNA was cloned in TA cloning vector and labeled with 32PdCTP. The use of this as a probe detected the presence of a hybridizing band in infected okra plants, while no signal was observed in extracts from cotton plants showing symptoms of CLCuD. These results show that OLCD in Pakistan is associated with a DNA beta molecule that is distinct from that reported on cotton and Ageratum. In particular, the DNA beta of CLCuD and OLCD originating from Pakistan are sufficiently diverse not to cross-hybridize under the conditions used here, and are most likely different disease complexes. To our knowledge this is the first report of the association of a whitefly-transmitted begomovirus/DNA 1/DNA beta complex with okra leaf curl disease. References: (1) R. W. Briddon et al. Virology, 2001 (In press). (2) S. Mansoor et al. Virology 259:190, 1999. (3) M R. Rojas et al. Plant Dis. 77: 340, 1993. (4) K. Saunders et al. PNAS 97:6890, 2000.

Silencing of the AV2 gene by antisense RNA protects transgenic plants against a bipartite begomovirus.

Whitefly-transmitted geminiviruses (genus Begomovirus) are phytopathogens that cause heavy losses to crops worldwide. Efforts to engineer resistance against these viruses are focused mainly on silencing of complementary-sense virus genes involved in virus replication. Here we have targeted a virion-sense gene (AV2) to develop resistance against Tomato leaf curl New Delhi virus, a bipartite begomovirus prevalent throughout the Indian subcontinent. We show that tobacco plants transformed with an antisense construct targeting this gene are resistant to the virus. Following challenged with the virus, transgenic plants remained symptomless, although viral DNA could be detected in some plants by PCR. This is the first report of transgenic resistance against a bipartite begomovirus obtained by targeting a virion-sense gene. The relatively conserved nature of the gene suggests that the technology may be useful to develop broad-spectrum resistance which is required because of the fact that plants are often infected with multiple begomoviruses in the field.

Evidence that watermelon leaf curl disease in Pakistan is associated with tomato leaf curl virus-India, a bipartite begomovirus.

Whitefly-transmitted geminiviruses (begomoviruses) have emerged as major constraints on food and fiber crops worldwide, and there are several examples of begomovirus mobilization in previously unknown host plants. Here we report on evidence that leaf curl disease of watermelon in Pakistan is caused by Tomato leaf curl virus-India (TLCV-India). Leaf curl disease of watermelon, characterized by leaf curling and mottling and stunted plant growth, was observed at several locations in the Punjab Province of Pakistan. Symptomatic and asymptomatic leaf samples were collected from three locations, and total DNA was isolated by the cetyltrimethylammoniumbromide method and resolved in agarose gel. A full-length clone of Cotton leaf curl virus DNA A was labeled with [32P]dCTP and used as a general probe in Southern hybridization. The probe detected characteristic geminivirus DNA forms in infected watermelon plants, whereas no signal was detected in asymptomatic plants. The association of a begomovirus was confirmed further by polymerase chain reaction (PCR) amplification with degenerate primers PAL1V and pAR1c (2). Samples were screened for infection by TLCV-India, because of symptom similarity. A full-length clone of DNA B of TLCV-India (1) was labeled with [32P]dCTP by random priming and was used as a specific probe in Southern hybridization. The probe detected geminivirus DNA forms, showing that the disease is associated with TLCV-India. Primers TLCV1 (GAGGTACCAAAACTTGTCGTTTTGATTCGG), in the virion-sense, and TLCV2 (GCCCATGGTTCTTTGCTCGGAGAACAAGAA), in the complementary-sense, were designed based on the sequence of DNA A of TLCV-India. These primers were used in PCR and amplified a product of the expected size from infected plants. Similarly, primers TLCVBC1 (GCGGATCCTTATTCCGTAATTATATCTGCA), in the virion-sense, and TLCV BC2 (CACCATGGCAATAGGAAATGATGGTATGGG), in the complementary-sense, were designed based on the sequence of DNA B of TLCV-India (1). These primers amplified a product of expected size when used in PCR. The results show that watermelon leaf curl disease in Pakistan is associated with TLCV-India. This the first report of detection of a begomovirus in watermelon in Pakistan and the first report of detection of TLCV-India on a plant other than tomato from Southeast Asia. References: (1) M. Padidam et al. J. Gen. Virol. 76:25, 1995. (2) M. R. Rojas et al. Plant Dis. 77:340, 1993.

Widespread occurrence of cotton leaf curl virus on radish in Pakistan.

The current epidemic of cotton leaf curl disease (CLCuD) in Pakistan started in 1988 with the natural host range limited to a few plant species in the family Malvaceae. However, we have observed expansion in the host range of the virus, and several non-Malvaceous plants were found to be infected with the virus. Characteristic symptoms of CLCuD such as leaf curl and enations have been observed on radish plants, primarily in kitchen gardens. However, in 1999, levels of infection of 10 to 90% were observed both in commercial fields and kitchen gardens in the Punjab province of Pakistan. Both symptomatic and nonsymptomatic samples were collected from five different locations. Total DNA was isolated, dot-blotted on nylon membrane, and a full-length clone corresponding to DNA A of cotton leaf curl virus was labeled with 32P dCTP and used as a probe for the detection of a begomovirus. Strong signals were observed in symptomatic plants while no signals were observed in nonsymptomatic plants. Infection with a begomovirus was further confirmed by polymerase chain reaction (PCR) using degenerate primers for DNA A (1). Primers specific for the two distinct begomoviruses associated with CLCuD were also used in PCR reactions (2), and products of the expected size were obtained from all symptomatic samples, confirming infection with begomoviruses similar to those associated with CLCuD. A full-length probe of a nanovirus-like molecule associated with cotton leaf disease (3), called DNA 1 was labeled with 32P dCTP and detected the virus only in symptomatic plants. Similarly, primers specific for DNA 1 (3) amplified a product of expected size when used in PCR. On the basis of symptomatology and the detection of specific viral components associated with the disease, we confirmed that radish plants are infected with Cotton leaf curl virus (CLCuV). Since radish is a short duration crop, infection of CLCuV in radish may not serve as a direct source of infection for the next cotton crop. However, it is a potential threat to tomato crops which overlap with radish in the Punjab province. The detection of CLCuD in radish is another example of the mobilization of begomoviruses to previously unknown hosts. References: (1) M. R. Rojas et al. Plant Dis. 77:340, 1993. (2) S. Mansoor et al. Pak. J. Bot. 31:115, 1999. (3) Mansoor et al. Virology 259:190, 1999.

Complete nucleotide sequence of a begomovirus and associated betasatellite infecting croton (Croton bonplandianus) in Pakistan

The complete sequences of a begomovirus and an associated betasatellite isolated from Croton bonplandianus originating from Pakistan were determined. The sequence of the begomovirus showed the highest level of nucleotide sequence identity (88.9%) to an isolate of papaya leaf curl virus and thus represents a new species, for which we propose the name Croton yellow vein virus (CYVV). The sequence of the betasatellite showed the highest levels of sequence identity (82 to 98.4%) to six sequences in the databases that have yet to be reported, followed by isolates of tomato leaf curl Joydebpur betasatellite (48.7 to 52.5%). This indicates that the betasatellite identified here (and the six sequences in the databases) is an isolate of a newly identified species for which the name Croton yellow vein mosaic betasatellite (CroYVMB) is proposed. For the begomovirus, an analysis of the sequence indicates that it has a recombinant origin.

Selection of target sequences as well as sequence identity determine the outcome of RNAi approach for resistance against cotton leaf curl geminivirus complex

Cotton leaf curl disease is caused by a geminivirus complex that involves multiple distinct begomoviruses and a disease-specific DNA satellite, cotton leaf curl Multan betasatellite (CLCuMB), which is essential to induce disease symptoms. Here we have investigated the use of RNA interference (RNAi) for obtaining resistance against one of the viruses, Cotton leaf curl Multan virus (CLCuMV), associated with the disease. Three hairpin RNAi constructs were produced containing either complementary-sense genes essential for replication/pathogenicity or non-coding regulatory sequences of CLCuMV. In transient assays all three RNAi constructs significantly reduced the replication of the virus in inoculated tissues. However, only one of the constructs, that targeting the overlapping genes involved in virus replication and pathogenicity (the replication-associated protein (Rep), the transcriptional activator protein and the replication enhancer protein) was able to prevent systemic movement of the virus, although the other constructs significantly reduced the levels of virus in systemic tissues. In the presence of CLCuMB, however, a small number of plants co-inoculated with even the most efficient RNAi construct developed symptoms of virus infection, suggesting that the betasatellite may compromise resistance. Further analyses, using Rep gene sequences of distinct begomoviruses expressed from a PVX vector as the target, are consistent with the idea that the success of the RNAi approach depends on sequence identity to the target virus. The results show that selection of both the target sequence, as well as the levels of identity between the construct and target sequence, determine the outcome of RNAi-based resistance against geminivirus complexes.

Association of a begomovirus and nanovirus-like molecule with Ageratum yellow vein disease in Pakistan.

Whitefly-transmitted geminiviruses (begomoviruses) cause heavy losses to many food and fiber crops in Pakistan. Many weeds also show symptoms typical of begomoviruses. Ageratum (Ageratum conyzoides) is a common perennial weed in Pakistan, growing along irrigation canals, that often shows symptoms, such as yellow vein and mosaic, suggesting infection by a begomovirus. To confirm this, symptomatic and asymptomatic ageratum plants were collected from three locations in the Punjab Province of Pakistan, and total DNA was isolated, subjected to agarose gel electrophoresis, transferred to a nylon membrane, and Southern blotted. Total DNA isolated from cotton infected with Cotton leaf curl virus (CLCuV), tomato infected with Tomato leaf curl virus from Pakistan (TLCV-Pak), tobacco infected with African cassava mosaic virus (ACMV) from Nigeria, and healthy tobacco were included as controls. A full-length clone of CLCuV DNA A was labeled with [32P]dCTP by oligo-labeling and hybridized at medium stringency. The probe detected characteristic geminivirus DNA forms in symptomatic ageratum and plants infected with CLCuV, TLCV-Pak, and ACMV, while no signal was detected in asymptomatic ageratum from the field or healthy tobacco. To confirm infection by a begomovirus, degenerate primers WTGF (5-GATTGTACGCGTCCDCCTTTAATTT GAAYBGG-3), designed in the rep gene of begomoviruses, and WTGR (5-TANACGCGTGGC TTCKRTACATGGCCTDT-3), designed in the coat protein gene of DNA A of begomoviruses, were used in polymerase chain reaction (PCR). Degenerate primers (PBLv2040 and PCRc1) also were used in PCR (2). A product of expected size (≈1.4 kb) was obtained with DNA A primers from symptomatic ageratum, while no product was obtained with DNA B primers in the same sample. Previously we were unable to detect a DNA component equivalent to begomovirus DNA B in cotton showing symptoms of cotton leaf curl disease (1). We recently reported a novel circular DNA molecule that was approximately half as long as the full-length DNA A (CLCuV DNA-1) associated with CLCuV that share homology to plant nanoviruses (1). The supercoiled replicative form of viral DNA isolated from infected ageratum plants indicated the presence of smaller molecules, as was found in cotton leaf curl disease, suggesting that a nanovirus-like molecule might be associated with ageratum yellow vein disease. A duplicate blot of samples used in Southern hybridization with the DNA A probe was prepared, and a probe of the full-length clone of the nanovirus-like molecule (CLCuV DNA-1) was prepared as described for DNA A. The probe detected characteristic nanovirus DNA forms in ageratum with yellow vein symptoms and cotton infected with CLCuV, while no signal was detected in plants infected with TLCV-Pak or ACMV, healthy tobacco, or asymptomatic ageratum. Abutting primers PB2-F and PB2R (1), designed based on the CLCuV DNA-1 sequence, were unable to amplify a PCR product from ageratum with yellow vein symptoms, suggesting the nanovirus-like molecule associated with ageratum yellow vein disease is distinct from CLCuV DNA-1. Our results show that yellow vein disease of ageratum in Pakistan is associated with a begomovirus infection and single-stranded circular DNA molecule with similarity to CLCuV DNA-1. References: (1) S. Mansoor et al. Virology 259:190, 1999. (2) M. R. Rojas et al., Plant Dis. 77:340, 1993.