M F Martelli

Cell line OCI/AML3 bears exon-12 NPM gene mutation-A and cytoplasmic expression of nucleophosmin

We recently identified a new acute myeloid leukemia (AML) subtype characterized by mutations at exon-12 of the nucleophosmin (NPM) gene and aberrant cytoplasmic expression of NPM protein (NPMc+). NPMc+ AML accounts for about 35% of adult AML and it is associated with normal karyotype, wide morphological spectrum, CD34-negativity, high frequency of FLT3-ITD mutations and good response to induction therapy. In an attempt to identify a human cell line to serve as a model for the in vitro study of NPMc+ AML, we screened 79 myeloid cell lines for mutations at exon-12 of NPM. One of these cell lines, OCI/AML3, showed a TCTG duplication at exon-12 of NPM. This mutation corresponds to the type A, the NPM mutation most frequently observed in primary NPMc+ AML. OCI/AML3 cells also displayed typical phenotypic features of NPMc+ AML, that is, expression of macrophage markers and lack of CD34, and the immunocytochemical hallmark of this leukemia subtype, that is, the aberrant cytoplasmic expression of NPM. The OCI/AML3 cell line easily engrafts in NOD/SCID mice and maintains in the animals the typical features of NPMc+ AML, such as the NPM cytoplasmic expression. For all these reasons, the OCI/AML3 cell line represents a remarkable tool for biomolecular studies of NPMc+ AML.

Cytoplasmic mutated nucleophosmin (NPM) defines the molecular status of a significant fraction of myeloid sarcomas.

Cytoplasmic mutated nucleophosmin (NPM) defines the molecular status of a significant fraction of myeloid sarcomas

Identification and functional characterization of a cytoplasmic nucleophosmin leukaemic mutant generated by a novel exon-11 NPM1 mutation

Identification and functional characterization of a cytoplasmic nucleophosmin leukaemic mutant generated by a novel exon-11 NPM1 mutation

Aberrant subcellular expression of nucleophosmin and NPM-MLF1 fusion protein in acute myeloid leukaemia carrying t(3;5): a comparison with NPMc+ AML.

Aberrant subcellular expression of nucleophosmin and NPM-MLF1 fusion protein in acute myeloid leukaemia carrying t(3;5): A comparison with NPMc+ AML

In human genome, generation of a nuclear export signal through duplication appears unique to nucleophosmin ( NPM1 ) mutations and is restricted to AML

In human genome, generation of a nuclear export signal through duplication appears unique to nucleophosmin ( NPM1 ) mutations and is restricted to AML

TPM3/PDGFRB fusion transcript and its reciprocal in chronic eosinophilic leukemia.

Using metaphase fluorescence in situ hybridization (FISH) to narrow translocation breakpoints and polymerase chain reaction (PCR) to identify genes, we detected the TPM3 gene at 1q21 as a new PDGFRB partner in chronic eosinophilic leukemia (CEL). CEL is defined by a persistent eosinophil count X1.5 10/l with no known underlying causes, organ involvement, evidence of eosinophil clonality or increased blasts. In 30–40% of patients with male predominance and high incidence of hepatomegaly and splenomegaly, CEL is associated with del(4)(q12)/FIP1L1-PDGFRA genomic change. Rare cases show 5q31–q33 rearrangements, in a few of which PDGFRB is involved. Interestingly, a t(1;5)(q21;q33) disrupting PDGFRB has been reported in one case classified as atypical chronic myeloid leukemia (aCML)/CEL. In 1991, a 21-year-old man with CEL showed a 46,XY, t(1;5)(q21;q33) karyotype in 28/29 metaphases. Under a-interferon treatment, which was administered for 10 years, the patient obtained a major cytogenetic response. In April 2002, imatinib therapy provided hematological, cytogenetic and FISH remission, which was maintained until the last checkup in January 2005. Metaphase FISH was performed using a bone marrow sample taken at diagnosis. Cosmid 9-4 for the 30 PDGFRB (green) and cosmid 4-1 for the 50 PDGFRB (red) gave a red/green fusion signal on normal 5, a green signal on der(5) and a red signal on der(1) indicating PDGFRB was rearranged. The long arm of chromosome 1 was examined with a panel of 17 DNA clones mapping at bands 1q21–q23 (from centromere to telomere: RP11-97A5, RP11-235D19, RP11-68I18, RP11-98D18, RP1192M2, RP11-182L11, RP11-128L15, RP11-49N14, RP11-354A16, RP11-216N14, RP11-759F5, RP11-422P24, RP11-144B19, RP11205M9, RP11-350G8, RP11-274N19, RP11-107D16). The breakpoint fell within clone RP11-205M9, which gave three hybridization signals on normal chromosome 1, on der(1) and on der(5). All the other clones gave two hybridization signals: those more centromeric than RP11-205M9 on normal 1 and on der(1), and those more telomeric on normal 1 and on der(5). The RP11-205M9 clone mapping at the 1q21.2 band corresponds to a region that contains the following genes: C1orf43, the ubiquitin associated protein 2-like (UBAP2L) and tropomyosin 3 (TPM3). A TPM3/PDGFRB fusion transcript was amplified by seminested reverse transcriptase (RT)-PCR. Patient RNA was extracted with Trizol (Invitrogen, Carlsbad, CA, USA) from a bone marrow sample taken at diagnosis and retro-transcribed using the Thermoscript RT-PCR System (Invitrogen) (Figure 1a). The first round of amplification was performed with primers TPM3_425F (AGGTGGCTCGTAAGTTGGTG) and PDGFRB_2369R (TAGATGGGTCCTCCTTTGGTG) and the second with primers TPM3_425F and PDGFRBR1 (TAAG CATCTTGACGGCCACT). The product was cloned in pGEM-T Easy Vector System (Promega, Madison, WI, USA). Sequencing confirmed amplification of a chimeric transcript fusing exon 7 of TPM3 isoform 2 (GenBank accession no. NM_153649) with exon 11 of PDGFRB (Figure 1b). The reciprocal PDGFRB/ TPM3 fusion transcript was sought by RT-PCR using primers PDGFRB_1686F (CCGAACATCATCTGGTCTGC) and TPM3v2_1158R (GGATTCGATTGCTGCTTCAG), followed by nested PCR with primers PDGFRB-1810F (AGGAGCAG GAGTTTGAGGTG) and TPM3_919R (GGTGGTGAAAGGA GAAAGCA). We detected and sequenced a PDGFRB/TPM3 fusion transcript joining exon 10 of PDGFRB to exon 8 of TPM3 (data not shown). So one case of imatinib mesylate-sensitive CEL with t(1;5)(q21;q33) is, for the first time, observed to produce TPM3/PDGFRB with its reciprocal PDGFRB/TPM3 fusion. TPM3 is an actin-binding protein whose muscle isoform mediates myosin–actin response to calcium ions in skeletal muscles and whose non-muscle isoform is found in cytoskeletal microfilaments. A heterozygous TPM3 germline mutation is associated with the autosomal dominant form of nemaline myopathy. When fused to tyrosine kinases, TPM3 participates with its 221 NH2-terminal amino acids (encoded by exons 1–7), which contain the coiled-coil dimerization domain. In anaplastic cell lymphomas and in inflammatory myofibroblastic tumors with t(1;2)(q25;p23), TPM3 gene rearranges with ALK (anaplastic cell lymphoma kinase). In colon carcinoma and in papillary thyroid carcinomas, TPM3 rearranges with the nearby neurotrophic tyrosine kinase, receptor, type 1 (NTRK1/1q23) gene. In 20% of human papillary thyroid carcinomas, the H4/ D10S170 gene, at 10q21, is partner of the receptor tyrosine kinase RET in the inv(10)(q11.2q21). Interestingly, the H4/ D10S170 gene is another partner of PDGFRB, in aCML with

CIZ gene rearrangements in acute leukemia: report of a diagnostic FISH assay and clinical features of nine patients

CIZ gene rearrangements in acute leukemia: report of a diagnostic FISH assay and clinical features of nine patients

A western blot assay for detecting mutant nucleophosmin (NPM1) proteins in acute myeloid leukaemia

A western blot assay for detecting mutant nucleophosmin (NPM1) proteins in acute myeloid leukaemia

A new NDE1/PDGFRB fusion transcript underlying chronic myelomonocytic leukaemia in Noonan Syndrome.

A new NDE1/PDGFRB fusion transcript underlying chronic myelomonocytic leukaemia in Noonan Syndrome

A PDGFRB-positive acute myeloid malignancy with a new t(5;12)(q33;p13.3) involving the ERC1 gene.

A PDGFRB -positive acute myeloid malignancy with a new t(5;12)(q33;p13.3) involving the ERC1 gene