R La Starza

Aberrant subcellular expression of nucleophosmin and NPM-MLF1 fusion protein in acute myeloid leukaemia carrying t(3;5): a comparison with NPMc+ AML.

Aberrant subcellular expression of nucleophosmin and NPM-MLF1 fusion protein in acute myeloid leukaemia carrying t(3;5): A comparison with NPMc+ AML

The ETV6, CDKN1B and D12S178 loci are involved in a segment commonly deleted in various 12p aberrations in different hematological malignancies

Structural rearrangements including deletions of the short arm of chromosome 12 are frequent cytogenetic findings in various hematologic malignant disorders. Using FISH with a panel of DNA probes we detected loss of a common region of 12p in 22 patients with different hematologic disorders. Nine of them were characterized cytogenetically by a del(12p), seven by unbalanced translocations, and in the remaining cases the loss of the 12p region was masked by translocations and insertions, adding extra material to the short arm of chromosome 12. The smallest commonly deleted region found in all cases analyzed included ETV6, the gene for p27kipl (CDKN1B), and the D12S178 marker.

TPM3/PDGFRB fusion transcript and its reciprocal in chronic eosinophilic leukemia.

Using metaphase fluorescence in situ hybridization (FISH) to narrow translocation breakpoints and polymerase chain reaction (PCR) to identify genes, we detected the TPM3 gene at 1q21 as a new PDGFRB partner in chronic eosinophilic leukemia (CEL). CEL is defined by a persistent eosinophil count X1.5 10/l with no known underlying causes, organ involvement, evidence of eosinophil clonality or increased blasts. In 30–40% of patients with male predominance and high incidence of hepatomegaly and splenomegaly, CEL is associated with del(4)(q12)/FIP1L1-PDGFRA genomic change. Rare cases show 5q31–q33 rearrangements, in a few of which PDGFRB is involved. Interestingly, a t(1;5)(q21;q33) disrupting PDGFRB has been reported in one case classified as atypical chronic myeloid leukemia (aCML)/CEL. In 1991, a 21-year-old man with CEL showed a 46,XY, t(1;5)(q21;q33) karyotype in 28/29 metaphases. Under a-interferon treatment, which was administered for 10 years, the patient obtained a major cytogenetic response. In April 2002, imatinib therapy provided hematological, cytogenetic and FISH remission, which was maintained until the last checkup in January 2005. Metaphase FISH was performed using a bone marrow sample taken at diagnosis. Cosmid 9-4 for the 30 PDGFRB (green) and cosmid 4-1 for the 50 PDGFRB (red) gave a red/green fusion signal on normal 5, a green signal on der(5) and a red signal on der(1) indicating PDGFRB was rearranged. The long arm of chromosome 1 was examined with a panel of 17 DNA clones mapping at bands 1q21–q23 (from centromere to telomere: RP11-97A5, RP11-235D19, RP11-68I18, RP11-98D18, RP1192M2, RP11-182L11, RP11-128L15, RP11-49N14, RP11-354A16, RP11-216N14, RP11-759F5, RP11-422P24, RP11-144B19, RP11205M9, RP11-350G8, RP11-274N19, RP11-107D16). The breakpoint fell within clone RP11-205M9, which gave three hybridization signals on normal chromosome 1, on der(1) and on der(5). All the other clones gave two hybridization signals: those more centromeric than RP11-205M9 on normal 1 and on der(1), and those more telomeric on normal 1 and on der(5). The RP11-205M9 clone mapping at the 1q21.2 band corresponds to a region that contains the following genes: C1orf43, the ubiquitin associated protein 2-like (UBAP2L) and tropomyosin 3 (TPM3). A TPM3/PDGFRB fusion transcript was amplified by seminested reverse transcriptase (RT)-PCR. Patient RNA was extracted with Trizol (Invitrogen, Carlsbad, CA, USA) from a bone marrow sample taken at diagnosis and retro-transcribed using the Thermoscript RT-PCR System (Invitrogen) (Figure 1a). The first round of amplification was performed with primers TPM3_425F (AGGTGGCTCGTAAGTTGGTG) and PDGFRB_2369R (TAGATGGGTCCTCCTTTGGTG) and the second with primers TPM3_425F and PDGFRBR1 (TAAG CATCTTGACGGCCACT). The product was cloned in pGEM-T Easy Vector System (Promega, Madison, WI, USA). Sequencing confirmed amplification of a chimeric transcript fusing exon 7 of TPM3 isoform 2 (GenBank accession no. NM_153649) with exon 11 of PDGFRB (Figure 1b). The reciprocal PDGFRB/ TPM3 fusion transcript was sought by RT-PCR using primers PDGFRB_1686F (CCGAACATCATCTGGTCTGC) and TPM3v2_1158R (GGATTCGATTGCTGCTTCAG), followed by nested PCR with primers PDGFRB-1810F (AGGAGCAG GAGTTTGAGGTG) and TPM3_919R (GGTGGTGAAAGGA GAAAGCA). We detected and sequenced a PDGFRB/TPM3 fusion transcript joining exon 10 of PDGFRB to exon 8 of TPM3 (data not shown). So one case of imatinib mesylate-sensitive CEL with t(1;5)(q21;q33) is, for the first time, observed to produce TPM3/PDGFRB with its reciprocal PDGFRB/TPM3 fusion. TPM3 is an actin-binding protein whose muscle isoform mediates myosin–actin response to calcium ions in skeletal muscles and whose non-muscle isoform is found in cytoskeletal microfilaments. A heterozygous TPM3 germline mutation is associated with the autosomal dominant form of nemaline myopathy. When fused to tyrosine kinases, TPM3 participates with its 221 NH2-terminal amino acids (encoded by exons 1–7), which contain the coiled-coil dimerization domain. In anaplastic cell lymphomas and in inflammatory myofibroblastic tumors with t(1;2)(q25;p23), TPM3 gene rearranges with ALK (anaplastic cell lymphoma kinase). In colon carcinoma and in papillary thyroid carcinomas, TPM3 rearranges with the nearby neurotrophic tyrosine kinase, receptor, type 1 (NTRK1/1q23) gene. In 20% of human papillary thyroid carcinomas, the H4/ D10S170 gene, at 10q21, is partner of the receptor tyrosine kinase RET in the inv(10)(q11.2q21). Interestingly, the H4/ D10S170 gene is another partner of PDGFRB, in aCML with

CIZ gene rearrangements in acute leukemia: report of a diagnostic FISH assay and clinical features of nine patients

CIZ gene rearrangements in acute leukemia: report of a diagnostic FISH assay and clinical features of nine patients

A new NDE1/PDGFRB fusion transcript underlying chronic myelomonocytic leukaemia in Noonan Syndrome.

A new NDE1/PDGFRB fusion transcript underlying chronic myelomonocytic leukaemia in Noonan Syndrome

CALM/AF10 -positive leukemias show upregulation of genes involved in chromatin assembly and DNA repair processes and of genes adjacent to the breakpoint at 10p12

The t(10;11)(p12;q14) is a recurring chromosomal translocation that gives rise to the CALM/AF10 fusion gene, which is found in acute myeloid leukemia, acute lymphoblastic leukemia and malignant lymphoma. We analyzed the fusion transcripts in 20 new cases of CALM/AF10-positive leukemias, and compared the gene expression profile of 10 of these to 125 patients with other types of leukemia and 10 normal bone marrow samples. Based on gene set enrichment analyses, the CALM/AF10-positive samples showed significant upregulation of genes involved in chromatin assembly and maintenance and DNA repair process, and downregulation of angiogenesis and cell communication genes. Interestingly, we observed a striking upregulation of four genes located immediately centromeric to the break point of the t(10;11)(p12;q14) on 10p12 (COMMD3 (COMM domain containing 3), BMI1 (B lymphoma Mo-MLV insertion region 1 homolog), DNAJC1 (DnaJ (Hsp40) homolog subfamily C member 1) and SPAG6 (sperm associated antigen 6)). We also conducted semiquantitative reverse transcriptase-PCR analysis on leukemic blasts from a murine CALM/AF10 transplantation model that does not have the translocation. Commd3, Bmi1 and Dnajc1, but not Spag6 were upregulated in these samples. These results strongly indicate that the differential regulation of these three genes is not due to the break point effect but as a consequence of the CALM/AF10 fusion gene expression, though the mechanism of regulation is not well understood.

A PDGFRB-positive acute myeloid malignancy with a new t(5;12)(q33;p13.3) involving the ERC1 gene.

A PDGFRB -positive acute myeloid malignancy with a new t(5;12)(q33;p13.3) involving the ERC1 gene

Different genomic imbalances in low- and high-grade HCV-related lymphomas.

Chronic infection with hepatitis C virus (HCV) is related to monoclonal B-cell lymphoproliferative disorders including a benign monoclonal lymphoproliferation such as type II mixed cryoglobulinemia, and B-cell non-Hodgkins lymphomas (NHL).

Distinct genomic events in the myeloid and lymphoid lineages in simultaneous presentation of chronic myeloid leukemia and B-chronic lymphocytic leukemia

Distinct genomic events in the myeloid and lymphoid lineages in simultaneous presentation of chronic myeloid leukemia and B-chronic lymphocytic leukemia

Prognostic impact of genetic characterization in the GIMEMA LAM99P multicenter study for newly diagnosed acute myeloid leukemia

The findings of this study reiterate the prognostic relevance of combining cytogenetic and mutational analysis (NPM1, FTT3) in the diagnostic work up of acute myeloid leukemia. See related perspective on page 976. Background Recent advances in genetic characterization of acute myeloid leukemia indicate that combined cytogenetic and molecular analyses provide better definition of prognostic groups. The aim of this study was to verify this prospectively in a large group of patients. Design and Methods Genetic characterization was prospectively carried out in 397 patients with acute myeloid leukemia (median age, 46 years) receiving uniform treatment according to the LAM99P protocol of the Italian GIMEMA group. The impact of genetic markers on response to therapy and outcome was assessed by univariate and multivariate analyses. Results For induction response, conventional karyotyping identified three groups with complete remission rates of 92%, 67% and 39% (p<0.0001). Complete remission rates in NPM1 mutated (NPM1+) and wild-type (NPM1-) groups were 76% and 60%, respectively, for the whole population and 81% and 61% in the group with normal karyotype (p<0.001 and p=0.026, respectively). Multivariate analysis indicated that low risk karyotype and NPM1+ were independent factors favorably affecting complete remission. Multivariate analysis of overall and disease-free survival among 269 patients who achieved complete remission showed a significant impact of karyotype on both estimates and of FLT3 status on disease free-survival (FLT3-ITD vs. FLT3 wild-type, p=0.0001). NPM1 status did not significantly influence disease free-survival in either the whole population or in the patients with a normal karyotype in this series, probably due to the low number of cases analyzed. Conclusions These results reiterate the prognostic relevance of combining cytogenetic and mutational analysis in the diagnostic work up of patients with acute myeloid leukemia.