Zhijin Chen

Whole genome sequencing of a novel temperate bacteriophage of P. aeruginosa: evidence of tRNA gene mediating integration of the phage genome into the host bacterial chromosome

Whole genome sequencing of a novel Pseudomonas aeruginosa temperate bacteriophage PaP3 has been completed. The genome contains 45 503 bp with GC content of 52.1%, without more than 100 bp sequence hitting homologue in all sequenced phage genomes. A total of 256 open reading frames (ORFs) are found in the genome, and 71 ORFs are predicated as coding sequence (CDS). All 71 CDS are divided into the two opposite direction groups, and both groups meet at the bidirectional terminator site locating the near middle of the genome. The genome is dsDNA with 5′‐protruded cohesive ends and cohesive sequence is ′GCCGGCCCCTTTCCGCGTTA′ (20 mer). There are four tRNA genes (tRNAAsn, tRNAAsp, tRNATyr and tRNAPro) clustering at the 5′‐terminal of the genome. Analysis of integration site of PaP3 in the host bacterial genome confirmed that the core sequence of (GGTCGTAGGTTCGAATCCTAC‐21mer) locates at tRNAPro gene within the attP region and at tRNALys gene in the attB region. The results indicated that 3′‐end of tRNAPro gene of the PaP3 genome is involved in the integration reaction and 5′‐end of tRNALys gene of host bacteria genome is hot spot of the integration.

Molecular and phenotypic evidence for the spread of three major methicillin-resistant Staphylococcus aureus clones associated with two characteristic antimicrobial resistance profiles in China

OBJECTIVES The distribution of methicillin-resistant Staphylococcus aureus (MRSA) clones is dynamic and geographically unique. To understand the changing epidemiology of MRSA infections in China, we performed a prospective, multicity surveillance study with molecular typing and phenotypic analysis to determine the association of major prevalent clones with their antimicrobial resistance profiles. METHODS A total of 517 S. aureus isolates collected between January 2009 and March 2012 from six cities in China were subjected to antibiogram analysis and molecular typing, including staphylococcal cassette chromosome mec typing, multilocus sequence typing, staphylococcal protein A gene typing and PFGE typing. RESULTS Among the isolates collected, 309 were characterized as MRSA, with a prevalence of 59.8%. Three major clones were found to be prevalent in China: ST239-MRSA-III-t030, ST239-MRSA-III-t037 and ST5-MRSA-II-t002. These three clones were associated with two characteristic resistance profiles, namely, gentamicin/ciprofloxacin/rifampicin/levofloxacin for the first clone and gentamicin/ciprofloxacin/clindamycin/erythromycin/tetracycline/levofloxacin/trimethoprim/sulfamethoxazole for the latter two. Several geographically unique minor clones were also identified. CONCLUSIONS The predominant MRSA clones in China were associated with characteristic antimicrobial resistance profiles. Antibiotics for treating patients with MRSA infections can be selected based on the strain typing data.

Cell wall thickening is associated with adaptive resistance to amikacin in methicillin-resistant Staphylococcus aureus clinical isolates

OBJECTIVES Methicillin-resistant Staphylococcus aureus (MRSA) infection is increasing and causing global concern. The mechanism of MRSA resistance to amikacin is poorly understood. We report on the first matched-pair study to reveal that the phenotypic cell wall thickening of MRSA is associated with adaptive resistance to amikacin. METHODS Two MRSA strains (CY001 and CY002) were isolated from blood and synovial fluid samples, respectively, from a 12-year-old male patient with osteomyelitis. The strains were subjected to a matched-pair study, including antimicrobial agent susceptibility determination, molecular typing, morphological observation and in vitro resistance induction. RESULTS Both strains are Panton-Valentine leucocidin-positive, multilocus sequence type 59, staphylococcal cassette chromosome mec type IV and spa type 437 MRSA with identical PFGE profiles. The drug susceptibility spectra of the two isolates are similar. However, CY001 is resistant to amikacin (CY001-AMI(R); MIC = 64 mg/L), contrary to the susceptible CY002 (CY002-AMI(S); MIC = 8 mg/L). CY001-AMI(R) may have developed adaptive resistance, because it lacks aminoglycoside-modifying enzymes and has an altered growth curve. Interestingly, CY001-AMI(R) has a thicker cell wall (36.43 ± 4.25 nm) than CY002-AMI(S) (18.15 ± 3.74 nm) in the presence of amikacin at its MIC. The thickened cell wall can also be observed in an in vitro-induced strain (CY002-AMI(R)) in the presence of amikacin at its MIC (36.78 ± 3.41 nm); this strain was obtained by gradually increasing the amount of amikacin. However, the cell wall-thickened strains cultured in the presence of amikacin are still susceptible to vancomycin. CONCLUSIONS Cell wall thickening is associated with adaptive resistance in MRSA and alternative antibiotics can be used to treat patients when adaptive resistance to amikacin has developed.

Panton-Valentine Leukocidin (PVL)-Positive Health Care-Associated Methicillin-Resistant Staphylococcus aureus Isolates Are Associated with Skin and Soft Tissue Infections and Colonized Mainly by Infective PVL-Encoding Bacteriophages

ABSTRACT The emergence of Panton-Valentine leukocidin (PVL)-positive methicillin-resistant Staphylococcus aureus (MRSA) is a public health concern worldwide. PVL is associated with community-associated MRSA and is linked to skin and soft tissue infections (SSTIs). However, PVL genes have also been detected in health care-associated (HA) MRSA isolates. The diseases associated with PVL-positive HA-MRSA isolates and the distributions of PVL-encoding bacteriophages in HA-MRSA have not been determined. In this study, a total of 259 HA-MRSA strains isolated between 2009 and 2012 in China from inpatients with SSTIs, pneumonia, and bacteremia were selected for molecular typing, including staphylococcal cassette chromosome mec typing, multilocus sequence typing, and staphylococcal protein A gene typing. The PVL genes and PVL bacteriophages in the MRSA isolates were characterized by PCR. Among the tested MRSA isolates, 28.6% (74/259) were PVL positive. The high prevalence of PVL-carrying HA-MRSA was observed to be associated with SSTIs but not with pneumonia or bacteremia. The PVL-positive HA-MRSA isolates were colonized mainly by infective PVL phages, namely, Φ7247PVL, ΦSLT, and ΦSa2958. The distribution of PVL-carrying bacteriophages differed geographically. Our study highlights the potential risk of the emergence of multidrug-resistant HA-MRSA strains with increased virulence.

Characterization of swarming motility in Citrobacter freundii

Bacterial swarming motility is a flagella-dependent translocation on the surface environment. It has received extensive attention as a population behavior involving numerous genes. Here, we report that Citrobacter freundii, an opportunistic pathogen, exhibits swarming movement on a solid medium surface with appropriate agar concentration. The swarming behavior of C. freundii was described in detail. Insertional mutagenesis with transposon Mini-Tn5 was carried out to discover genetic determinants related to the swarming of C. freundii. A number of swarming genes were identified, among which flhD, motA, motB, wzx, rfaL, rfaJ, rfbX, rfaG, rcsD, rcsC, gshB, fabF, dam, pgi, and rssB have been characterized previously in other species. In mutants related to lipopolysaccharide synthesis and RcsCDB signal system, a propensity to form poorly motile bacterial aggregates on the agar surface was observed. The aggregates hampered bacterial surface migration. In several mutants, the insertion sites were identified to be in the ORF of yqhC, yeeZ, CKO_03941, glgC, and ttrA, which have never been shown to be involved in swarming. Our results revealed several novel characteristics of swarming motility in C. freundii which are worthy of further study.

Identification of lytic bacteriophage MmP1, assigned to a new member of T7-like phages infecting Morganella morganii

MmP1 (Morganella morganii phage 1) is a lytic bacteriophage newly isolated from the host bacterium M. morganii. The entire genome was sequenced, and final assembly yielded a 38,234bp linear double-stranded DNA (dsDNA) with a G+C content of 46.5%. In the MmP1 genome, 49 putative genes, 10 putative promoters and 2 predicted sigma-independent terminators were determined through bioinformatic analysis. A striking feature of the MmP1 genome is its high degree of similarity to the T7 group of phages. All of the 49 predicted genes exist on the same DNA strand, and functions were assigned to 35 genes based on the similarity of the homologues deposited in GenBank, which share 30-80% identity to their counterparts in T7-like phages. The analyses of MmP1 using CoreGenes, phylogenetic tree of RNA polymerase and structural proteins have demonstrated that bacteriophage MmP1 should be assigned as a new member of T7-like phages but as a relatively distant member of this family. This is the first report that a T7-like phage adaptively parasitizes in M. morganii, and this will advance our understanding of biodiversity and adaptive evolution of T7-like phages.

Characterization and genome sequencing of a novel coliphage isolated from engineered Escherichia coli.

Objectives: To characterize morphological, physicochemical and genomic features of a novel virulent coliphage which was isolated from an engineered Escherichia coli culture and termed engineered E. coli phage (EEP). Methods and Results: Electron microscopy revealed that EEP has an icosahedral head (62 nm in diameter) and a long, flexible tail (138 nm in length). EEP was able to infect all 10 engineered E. coli strains kept in our laboratory, showing a strong ability to lyse engineered E. coli. Sequencing of the EEP genome revealed a double-stranded DNA (39.8 kb) with 54.72% GC content. Fifty-two open reading frames were predicted to be coding sequences, 18 of which were functionally defined and organized in a modular format, which includes modules for DNA replication, DNA packaging, structural proteins and host cell lysis. This phage could not be inactivated at 90° for 45 min and was resistant to ethanol and alkali treatment. EEP is assigned to the Siphoviridae family based on its morphological, genomic and physicochemical properties. Conclusions: A novel coliphage was isolated from engineered E. coli strains, and its morphological, genomic and physicochemical properties were characterized, which will improve our knowledge of bacteriophage diversity.

Deletion of yncD gene in Salmonella enterica ssp. enterica serovar Typhi leads to attenuation in mouse model.

TonB-dependent transporters (TBDTs) are bacterial outer membrane proteins that are usually involved in the uptake of certain key nutrients, for example iron. In the genome of Salmonella enterica ssp. enterica serovar Typhi, the yncD gene encodes a putative TBDT and was identified recently as an in vivo-induced antigen. In the present study, a yncD-deleted mutant was constructed to evaluate the role of the yncD gene in virulence. Our results showed that the mutant is attenuated in a mouse model by intraperitoneal injection and its virulence is restored by the transformation of a complement plasmid. The competition experiments showed that the survival ability of the yncD-deleted mutant decreases significantly in vivo. To evaluate its vaccine potential, the yncD-deleted mutant was inoculated intranasally in the mouse model. The findings demonstrated a significant immunoprotection against the lethal wild-type challenge. The regulation analysis showed that yncD gene promoter is upregulated under acidic condition. The present study demonstrates that the yncD gene plays an important role in bacterial survival inside the host and is suitable for the construction of attenuated vaccine strains as a candidate target gene.

Vi capsular polysaccharide: Synthesis, virulence, and application

Abstract Vi capsular polysaccharide, a linear homopolymer of α-1,4-linked N-acetylgalactosaminuronate, is characteristically produced by Salmonella enterica serovar Typhi. The Vi capsule covers the surface of the producing bacteria and serves as an virulence factor via inhibition of complement-mediated killing and promoting resistance against phagocytosis. Furthermore, Vi also represents a predominant protective antigen and plays a key role in the development of vaccines against typhoid fever. Herein, we reviewed the latest advances associated with the Vi polysaccharide, from its synthesis and transport within bacterial cells, mechanisms involved in virulence, immunological characteristics, and applications in vaccine, as well as its purification and detection methods.

Safety and immunogenicity of an attenuated Salmonella enterica serovar Paratyphi A vaccine candidate

Enteric fever caused by Salmonella enterica serovar Paratyphi A has progressively increased in recent years and became a global health issue. Currently licensed typhoid vaccines do not confer adequate cross-immunoprotection against S. Paratyphi A infection. Therefore, vaccines specifically against enteric fever caused by S. Paratyphi A are urgently needed. In the present study, an attenuated vaccine strain was constructed from S. Paratyphi A CMCC50093 by the deletions of aroC and yncD. The obtained strain SPADD01 showed reduced survival within THP-1 cells and less bacterial burden in spleens and livers of infected mice compared with the wild-type strain. The 50% lethal doses of SPADD01 and the wild-type strain were assessed using a murine infection model. The virulence of SPADD01 is approximately 40,000-fold less than that of the wild-type strain. In addition, SPADD01 showed an excellent immunogenicity in mouse model. Single intranasal inoculation elicited striking humoral and mucosal immune responses in mice and yielded effective protection against lethal challenge of the wild-type strain. A high level of cross-reactive humoral immune response against LPS of Salmonella enterica serovar Typhi was also detected in immunized mice. However, SPADD01 vaccination only conferred a low level of cross-protection against S. Typhi. Our data suggest that SPADD01 is a promising vaccine candidate against S. Paratyphi A infection and deserves further evaluation in clinical trial. To date, no study has demonstrated a good cross-protection between serovars of S. Typhi and S. Paratyphi A, suggesting that the dominant protective antigens of both serovars are likely different and need to be defined in future study.